Skip to main content

We narrowed to 10,032 results for: ADA

Showing: 8741 - 8760 of 10032 results
  1. gRNA_Cloning Vector BbsI

    Plasmid
    #128433
    Purpose
    Embty backbone vector for expression of gRNA for spCas9 genome editing or epigenome editing
    Depositor
    Type
    Empty backbone
    Expression
    Mammalian
    Promoter
    U6 promoter
    Available Since
    July 26, 2019
    Availability
    Academic Institutions and Nonprofits only
  2. N174-MCS (Puro)

    Plasmid
    #81068
    Purpose
    Lentiviral vector for constitutive gene expression.
    Depositor
    Type
    Empty backbone
    Use
    Lentiviral
    Expression
    Mammalian
    Promoter
    EF-1α
    Available Since
    Aug. 30, 2016
    Availability
    Academic Institutions and Nonprofits only
  3. N174-MCS

    Plasmid
    #81061
    Purpose
    Lentiviral vector for constitutive gene expression.
    Depositor
    Type
    Empty backbone
    Use
    Lentiviral
    Expression
    Mammalian
    Promoter
    EF-1α
    Available Since
    Sept. 9, 2016
    Availability
    Academic Institutions and Nonprofits only
  4. pLS-mP-Luc

    Plasmid
    #106253
    Purpose
    Luciferase lentivirus based enhancer assay vector
    Depositor
    Insert
    Luciferase
    Use
    Lentiviral and Luciferase
    Promoter
    Derived from pGL4.23
    Available Since
    May 17, 2018
    Availability
    Academic Institutions and Nonprofits only
  5. cfSBFP2-N

    Plasmid
    #110633
    Purpose
    Cys-free blue fluorescent protein for extracellular imaging. SBFP2 variant (C48S/C70M). Molecular brightness is almost comparable to SBFP2.
    Depositor
    Insert
    cfSBFP2
    Mutation
    Cys48Ser/Cys70Met
    Available Since
    April 17, 2020
    Availability
    Academic Institutions and Nonprofits only
  6. pLS-SV40-mP-Rluc

    Plasmid
    #106292
    Purpose
    Luciferase lentivirus based enhancer assay vector
    Depositor
    Insert
    Luciferase
    Use
    Lentiviral and Luciferase
    Promoter
    Derived from pGL4.23
    Available Since
    June 12, 2018
    Availability
    Academic Institutions and Nonprofits only
  7. cfSYFP2-N

    Plasmid
    #110631
    Purpose
    Cys-free yellow fluorescent protein for extracellular imaging. SYFP2 variant (C48S/C70M). Molecular brightness is almost comparable to SYFP2.
    Depositor
    Insert
    cfSYFP2-N
    Tags
    Multi-cloning sites
    Expression
    Mammalian
    Mutation
    Cys48Ser and Cys70/Met
    Available Since
    April 17, 2020
    Availability
    Academic Institutions and Nonprofits only
  8. C63m

    Plasmid
    #120979
    Purpose
    MoClo golden gate assembly CD part for LacI (Lac repressor; identical to C1d but without ssrA degradation tag). Please see Supplemental Documents for annotated Genbank file.
    Depositor
    Insert
    lacI
    Use
    Synthetic Biology
    Available Since
    Dec. 4, 2019
    Availability
    Academic Institutions and Nonprofits only
  9. TLCV2-LoxP

    Plasmid
    #127098
    Purpose
    LentiCRISPR v2 was modified into an all-in-one dox inducible system.
    Depositor
    Insert
    Cas9-2A-eGFP
    Use
    Lentiviral
    Promoter
    U6
    Available Since
    June 10, 2019
    Availability
    Academic Institutions and Nonprofits only
  10. pCAG-hCas9D10A

    Plasmid
    #52101
    Purpose
    The expression vector for humanized nickase Cas9 (Cas9D10A) under CAG promoter
    Depositor
    Insert
    hCas9D10A
    Tags
    SV40 NLS
    Expression
    Mammalian
    Mutation
    D10A
    Promoter
    CAG
    Available Since
    April 30, 2014
    Availability
    Academic Institutions and Nonprofits only
  11. C27m

    Plasmid
    #120965
    Purpose
    MoClo golden gate assembly CD part for TetR (tet repressor; identical to C2d but without ssrA degradation tag). Please see Supplemental Documents for annotated Genbank file.
    Depositor
    Insert
    tetR (no deg tags)
    Use
    Synthetic Biology
    Available Since
    Dec. 4, 2019
    Availability
    Academic Institutions and Nonprofits only
  12. HT142_pAAV_EF1a_fDiO_Voltron2

    Plasmid
    #208607
    Purpose
    Expressing Voltron2 in a Flp-dependent manner
    Depositor
    Insert
    Voltron2
    Use
    AAV
    Tags
    Halo tag
    Promoter
    EF1a
    Available Since
    Nov. 14, 2023
    Availability
    Academic Institutions and Nonprofits only
  13. pT7-NSP4SA11-hPEST

    Plasmid
    #220820
    Purpose
    Express the Rotavirus SA11 NSP4 fused with the PEST degradation sequence from mouse ornithine decarboxylase
    Depositor
    Insert
    Rotavirus SA11 NSP4-hPEST
    Use
    Other
    Available Since
    Aug. 30, 2024
    Availability
    Academic Institutions and Nonprofits only
  14. C90m

    Plasmid
    #120998
    Purpose
    MoClo golden gate assembly CD part for NahR-sfGFP fusion (Adam Meyer improved NahR (C75m) fused to superfolder GFP (C3m)). Please see Supplemental Documents for annotated Genbank file.
    Depositor
    Insert
    NahRsfGFP fusion
    Use
    Synthetic Biology
    Available Since
    Dec. 4, 2019
    Availability
    Academic Institutions and Nonprofits only
  15. C92m

    Plasmid
    #121000
    Purpose
    MoClo golden gate assembly CD part for sfCFP-pdt3 (superfolder CFP developed by Ye Chen in Matthew Bennet's lab, with a pdt3 tag for mfLon protease).
    Depositor
    Insert
    sfCFPpdt3 (Chen,Bennett)
    Use
    Synthetic Biology
    Tags
    pdt3 mfLon degradation tag
    Available Since
    Dec. 4, 2019
    Availability
    Academic Institutions and Nonprofits only
  16. pcDNA3-TRAM-CFP

    Plasmid
    #13027
    Depositor
    Insert
    Toll-like Receptor Adaptor Molecule (TICAM2 Human)
    Tags
    CFP
    Expression
    Mammalian
    Available Since
    Nov. 3, 2006
    Availability
    Academic Institutions and Nonprofits only
  17. pOpen-K12polLF (exo-)

    Plasmid
    #165522
    Purpose
    DNA pol fragment used in flourescent labelling for microarray, dA and dT tailing, and ligating DNA adapters to DNA fragments.
    Insert
    DNA Polymerase I, Large (Klenow) Fragment (3'-5' exo-)
    Use
    Synthetic Biology
    Available Since
    Dec. 21, 2021
    Availability
    Industry, Academic Institutions, and Nonprofits
  18. RCAS IkB K->A

    Plasmid
    #12408
    Depositor
    Insert
    IkB alpha K->A (Nfkbia Mouse)
    Use
    Retroviral
    Expression
    Mammalian
    Mutation
    Lysines 21, 22, and 67 are mutated to alanine. (T…
    Available Since
    Aug. 17, 2006
    Availability
    Academic Institutions and Nonprofits only
  19. hPLD3-sgRNA-Cas9_mcherry

    Plasmid
    #199342
    Purpose
    encodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherry
    Depositor
    Insert
    hSpCas9
    Use
    CRISPR
    Tags
    P2A-RFP
    Expression
    Mammalian
    Promoter
    human U6
    Available Since
    May 22, 2024
    Availability
    Academic Institutions and Nonprofits only
  20. hPLD4-sgRNA-Cas9_mcherry

    Plasmid
    #199343
    Purpose
    encodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherry
    Depositor
    Insert
    hSpCas9
    Use
    CRISPR
    Tags
    P2A-mCherry
    Expression
    Mammalian
    Mutation
    sgRNA: accagtagtatgaagccacg
    Promoter
    human U6
    Available Since
    May 22, 2024
    Availability
    Academic Institutions and Nonprofits only
Showing: 8741 - 8760 of 10032 results