We narrowed to 10,032 results for: ADA
-
Plasmid#128433PurposeEmbty backbone vector for expression of gRNA for spCas9 genome editing or epigenome editingDepositorTypeEmpty backboneExpressionMammalianPromoterU6 promoterAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only
-
N174-MCS (Puro)
Plasmid#81068PurposeLentiviral vector for constitutive gene expression.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterEF-1αAvailable SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
N174-MCS
Plasmid#81061PurposeLentiviral vector for constitutive gene expression.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterEF-1αAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLS-mP-Luc
Plasmid#106253PurposeLuciferase lentivirus based enhancer assay vectorDepositorInsertLuciferase
UseLentiviral and LuciferasePromoterDerived from pGL4.23Available SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
cfSBFP2-N
Plasmid#110633PurposeCys-free blue fluorescent protein for extracellular imaging. SBFP2 variant (C48S/C70M). Molecular brightness is almost comparable to SBFP2.DepositorInsertcfSBFP2
MutationCys48Ser/Cys70MetAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLS-SV40-mP-Rluc
Plasmid#106292PurposeLuciferase lentivirus based enhancer assay vectorDepositorInsertLuciferase
UseLentiviral and LuciferasePromoterDerived from pGL4.23Available SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
cfSYFP2-N
Plasmid#110631PurposeCys-free yellow fluorescent protein for extracellular imaging. SYFP2 variant (C48S/C70M). Molecular brightness is almost comparable to SYFP2.DepositorInsertcfSYFP2-N
TagsMulti-cloning sitesExpressionMammalianMutationCys48Ser and Cys70/MetAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
C63m
Plasmid#120979PurposeMoClo golden gate assembly CD part for LacI (Lac repressor; identical to C1d but without ssrA degradation tag). Please see Supplemental Documents for annotated Genbank file.DepositorInsertlacI
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-LoxP
Plasmid#127098PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system.DepositorInsertCas9-2A-eGFP
UseLentiviralPromoterU6Available SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hCas9D10A
Plasmid#52101PurposeThe expression vector for humanized nickase Cas9 (Cas9D10A) under CAG promoterDepositorInserthCas9D10A
TagsSV40 NLSExpressionMammalianMutationD10APromoterCAGAvailable SinceApril 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
C27m
Plasmid#120965PurposeMoClo golden gate assembly CD part for TetR (tet repressor; identical to C2d but without ssrA degradation tag). Please see Supplemental Documents for annotated Genbank file.DepositorInserttetR (no deg tags)
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
HT142_pAAV_EF1a_fDiO_Voltron2
Plasmid#208607PurposeExpressing Voltron2 in a Flp-dependent mannerDepositorInsertVoltron2
UseAAVTagsHalo tagPromoterEF1aAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-NSP4SA11-hPEST
Plasmid#220820PurposeExpress the Rotavirus SA11 NSP4 fused with the PEST degradation sequence from mouse ornithine decarboxylaseDepositorInsertRotavirus SA11 NSP4-hPEST
UseOtherAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
C90m
Plasmid#120998PurposeMoClo golden gate assembly CD part for NahR-sfGFP fusion (Adam Meyer improved NahR (C75m) fused to superfolder GFP (C3m)). Please see Supplemental Documents for annotated Genbank file.DepositorInsertNahRsfGFP fusion
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
C92m
Plasmid#121000PurposeMoClo golden gate assembly CD part for sfCFP-pdt3 (superfolder CFP developed by Ye Chen in Matthew Bennet's lab, with a pdt3 tag for mfLon protease).DepositorInsertsfCFPpdt3 (Chen,Bennett)
UseSynthetic BiologyTagspdt3 mfLon degradation tagAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-TRAM-CFP
Plasmid#13027DepositorAvailable SinceNov. 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pOpen-K12polLF (exo-)
Plasmid#165522PurposeDNA pol fragment used in flourescent labelling for microarray, dA and dT tailing, and ligating DNA adapters to DNA fragments.DepositorInsertDNA Polymerase I, Large (Klenow) Fragment (3'-5' exo-)
UseSynthetic BiologyAvailable SinceDec. 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
RCAS IkB K->A
Plasmid#12408DepositorInsertIkB alpha K->A (Nfkbia Mouse)
UseRetroviralExpressionMammalianMutationLysines 21, 22, and 67 are mutated to alanine. (T…Available SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only