We narrowed to 74,154 results for: LAS
-
Plasmid#25275PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertTgCDPK4:P36-Q315
TagsHisExpressionBacterialMutationContains amino acids P36-Q315Available SinceAug. 13, 2010AvailabilityIndustry, Academic Institutions, and Nonprofits -
PP-BRD1
Plasmid#25282PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertPP-BRD1:N333-N480
TagsHisExpressionBacterialMutationContains amino acids N333-N480Available SinceAug. 30, 2010AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDNR-3xFLAG-T2A-3xPuroR-Frame 2
Plasmid#245868PurposeHITAG Donor plasmid for Frame 2 with 3xFLAG tag and triple Puromycin resistant marker (3xPuroR)DepositorInsert3xFLAG
UseSynthetic BiologyExpressionBacterial and MammalianAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-U6-ZNF865-UbC-DsRed-P2A-Bsr
Plasmid#241309PurposeLentiviral SpCas9-gRNA (ZNF865) expression vector with DsRed-Express2-P2A-BlastRDepositorInsertZNF865 gRNA (ZNF865 Human)
UseLentiviralAvailable SinceDec. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCODE-3
Plasmid#247475PurposePlasmid for inducible expression of six tRNA encoding genes (argX, glyT, leuW, proL, argU, and ileX) in Escherichia coli, based on pSEVA121 backboneDepositorInsertargX, glyT, leuW, proL, argU, and ileX
ExpressionBacterialMutationRearrangement of tRNA operon, tRNA flanking regio…PromoterpTetAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
DBJS-p2.25
Plasmid#246894PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid encoding guide for UBAP2L Nterm.DepositorInsertUBAP2L Nterm Guide RNA 1 (UBAP2L Human)
ExpressionMammalianAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tre3G-Flag-Rat Arc-Arc 3' UTR
Plasmid#233054PurposeTo express Flag-tagged Rat Arc from a TRE3g promoter. The Arc gene contains the Rat Arc 3'UTR containing NO intronsDepositorInsertRat Arc
UseAAVTagsFlagAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Actb Donor;3xV5 KO;Dlg4
Plasmid#240292PurposeKI:Actb Donor:3xV5 KO:Dlg4DepositorInsertKI gRNA for Actb
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2 GATD1 Alu_Mut2
Plasmid#205471PurposeLuciferase reporter for Alu Domain ActivityDepositorInsertMutant 2 GATD1 Alu Domain
UseLuciferase and RNAiMutationMutated the arms of the alu domain by adding ACAC…PromoterT7Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSm5-Bsd-P2a-Fkbp-3xF-GGSG
Plasmid#235522PurposeN-terminal tagging vector for Smarca5DepositorAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon-Synaptophysin-10xMyc-WPRE
Plasmid#237446PurposeIntersectional expression of Myc-tagged synaptophysin in the presence of Cre and FlpDepositorInsertCon/Fon-Synaptophysin-10xMyc
UseAAVExpressionMammalianPromoterEF1aAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_THADA_pos1toneg0
Plasmid#232388PurposeTHADA enhancer, one sensitizing element made into buffering CoordinatorDepositorInsertTHADA (THADA Human)
UseLuciferaseMutationTHADA enhancer, one sensitizing element made into…Available SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_MSR1_bothneg0scramble
Plasmid#232383PurposeMSR1 enhancer, both buffering Coordinators scrambledDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only