We narrowed to 10,922 results for: 158
-
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
C-His-GvpC-Calpain
Plasmid#153295PurposeExpresses calpain-sensitive variant of Anabaena flos-aquae GvpC in E.coliDepositorInsertCalpain-sensitive Gas vesicle protein C (his-tagged)
TagsHis-tagExpressionBacterialMutation1) Contains an extra glycine after the methionine…PromoterT7Available SinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α1.1-FLEX-rc [SomArchon-GFP]
Plasmid#153532PurposeAAV-mediated expression of SomArchon-GFP under the EF1α1.1 promoter, in floxed/reversed (Cre-dependent) manner.DepositorInsertSomArchon-GFP
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1α1.1Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgSIK3-A
Plasmid#138682PurposeExpresses a mouse SIK3-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgSIK3-C
Plasmid#138683PurposeExpresses a mouse SIK3-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTBL649 CHYRON2 integration construct
Plasmid#126446PurposeTo integrate the CHYRON2 locus at AAVS1 in human cells.DepositorInsertspU6-CHYRON2 hgRNA
pCMV-puro
ExpressionMammalianMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterCMV and human U6Available SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJC2297 - pHR-TRE3G-hSpCas9-NLS-FLAG-2A-Thy1.1
Plasmid#250251PurposeExpression of Cas9 with Thy1.1 cell surface marker under a doxycycline responsive promoter. Requires additional expression of transactivator.DepositorInserthSpCas9
UseCRISPR and LentiviralTagsNLS-FLAG-2A-Thy1.1PromoterTRE3GAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCBS-4804
Plasmid#249320PurposeExpresses Non-targeting sgRNA and contains the Repair Template to replace the KanR* on the genome of E. coli MG1655DepositorInsertnontargeting sgRNA
ExpressionBacterialMutationN/AAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCBS-5740
Plasmid#249327PurposeExpresses sgRNA targeting the fcy gene in S. cerevisiaeDepositorInsertsgRNA targeting fcy
ExpressionYeastMutationN/AAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-FAP-TGN38-GFP
Plasmid#242992PurposeInducible FAP-TGN38-GFP expression in mammalian cellsDepositorInsertdH6.2-TGN38-GFP (Tgoln2 Rat)
UseSleeping beautyTagsFAP and GFPExpressionMammalianPromoterTight TREAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-GFP-TGN38-FAP
Plasmid#242993PurposeInducible GFP-TGN38-FAP expression in mammalian cellsDepositorInsertGFP-TGN38-dH6.2 (Tgoln2 Rat)
UseSleeping beautyTagsFAP and GFPExpressionMammalianPromoterTight TREAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-mCer3-TGN38-FAP
Plasmid#242994PurposeInducible mCer3-TGN38-FAP expression in mammalian cellsDepositorInsertmCer3-TGN38-dH6.2 (Tgoln2 Rat)
UseSleeping beautyTagsFAP and mCer3ExpressionMammalianPromoterTight TREAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiX_(loxPconDIAL-YB_TATA)-mCherry-HRasG12V-BGH_pKG3906
Plasmid#246345PurposeloxPcon DIAL Reporter Lentivirus expressing mCherry-HRasG12V in the presence of ZFaDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEf1a-Dn29-dCas9-P2A-GFP
Plasmid#247155PurposeMammalian expression of a human codon optimized wildtype Dn29 recombinase fused to dCas9 and gRNA expression cassette for targeting attH1 with H1-g3DepositorInsertDn29-dCas9-P2A-GFP
TagsSV40 NLSExpressionMammalianPromoterEf1aAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSG5-CAGEc-ABL1 (Npu)
Plasmid#241420PurposeProximity-triggered Protein Trans-Splicing to generate the splice product BCR-ABL, Figure 3, Extended Figure 6-7 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-NUP98n-CAGEn-NES (Npu)
Plasmid#241417PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSG5-DNAJB1n_CAGEn (Nrdj1)
Plasmid#241422PurposeProximity-triggered Protein Trans-Splicing to generate the splice product DNAJ-PKAc, Figure 4, Extended Figure 8-9 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-BCRn-CAGEn (Npu)
Plasmid#241419PurposeProximity-triggered Protein Trans-Splicing to generate the splice product BCR-ABL, Figure 3, Extended Figure 6-7 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBI121::chitGFP5:AQ
Plasmid#240450PurposeExpression of indicator protein fusion (soluble modified GFP5 & Aequorin) for monitoring calcium concentrations in cell walls of higher plants. See Resource Information.DepositorInsertFusion of Chitinase signal, smGFP5, and Aequorin
ExpressionBacterial and PlantMutationGFP5 for expression plants (PMID 9122158); Solubl…PromoterCauliflower mosaic virus 35S promoter (GenBank AJ…Available SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-NUP98n-CAGEn-NES (Nrdj1)
Plasmid#241418PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Figure 2 & Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only