We narrowed to 27,307 results for: GFP
-
Plasmid#164840PurposeExpression of GFP tagged FL human talin2DepositorAvailable sinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pQP-2460
Plasmid#138973PurposeLight-induced recruitment of QPAS1-mCherry to the target protein bound to membrane; interaction occurs via intrabody fused to BphP1DepositorInsertNcoI-mVenus-CAAX-IRES2-BphP1- iB(GFP)- IRES2-NES-mCherry-Q-PAS1-NotI
Available sinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRaGE Pyl TAG GFP Y35TAG
Plasmid#160041PurposeEncodes for MmPyl tRNA synthetase/tRNA pair and for GFP reporter with TAG mutation at site 35, for unnatural amino acid incorporation into the GFP protein in Vibrio natriegens.DepositorInsertsPyrrolysyl tRNA synthetase (Methanosarcina mazei)
Pyrrolysyl tRNA(cua) (Methanosarcina mazei)
deGFP
UseSynthetic BiologyTagsHis-tagExpressionBacterialMutationChanged tyrosine 35 to TAG stop-codon (Site numbe…PromoterP70b promoter and T500 terminator, Vibrio natrieg…Available sinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-GFP-Sec61β
Plasmid#186597PurposeThird generation lentiviral vector expressing GFP-Sec61βDepositorAvailable sinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-IRAlus-Lin28
Plasmid#92347PurposePlasmid for expression of GFP gene with a Lin28 gene derived IR Alu element containing 3'UTR.DepositorInsertLin28 gene derived IR Alu element containing 3'UTR (LIN28A Human)
ExpressionMammalianPromoterCMVAvailable sinceJune 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-CYLD-STOP
Plasmid#60077PurposeN-terminal GFP tagged CYLD with stop codon, driven by CMV promoterDepositorAvailable sinceAug. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP553‐1
Plasmid#87240Purposegtbp‐1 (~500 bp flanking sequence)::GFP (with 3 introns)::gtbp‐1 (~500 bp flanking sequence)DepositorInsertgtbp‐1 (~500 bp flanking sequence)::GFP (with 3 introns)::gtbp‐1 (~500 bp flanking sequence)
Available sinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcryGFP-acta1-dmdGFP
Plasmid#172530PurposealphaA-crystallin promoter (cry) drives GFP expression in the lens. The acta1 muscle-specific promoter drives expression of GFP-tagged zebrafish dmd.DepositorAvailable sinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cas9-GFP_sg_mAMPKa1
Plasmid#79004PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse AMPK alpha 1.DepositorAvailable sinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pIRESN2 GFP-uvr8at
Plasmid#44969DepositorInsertGFP-UVR8 (UVR8 Mustard Weed, Synthetic)
TagsGFPExpressionMammalianMutationdeleted Methionine 1PromoterpCMV IEAvailable sinceJune 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
YIplac211-KAR2-msGFP2-HDEL
Plasmid#160468PurposeYeast integration vector for the gene replacement of S. cerevisiae KAR2 fused to msGFP2 with an ER retrieval signalDepositorInsertKAR2-msGFP2-HDEL
ExpressionYeastAvailable sinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
KIF3A560GFP
Plasmid#129769PurposeExpresses mouse Kinesin-2 KIF3A head and neck linker, dimerized through kinesin-1 neck-coil and coil-1 to 560 and GFP taggedDepositorInsertKIF3A (Kif3a Mouse)
TagsGFP and His6ExpressionBacterialMutationTruncation at 359, fused to kinesin-1 starting Al…Available sinceNov. 18, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCDH_blast_MCS_Nard_GFP_D50
Plasmid#167339PurposeExpresses GFP fused to progerin (d50) in mammalian cellsDepositorInsertProgerin
UseLentiviralTagsGFPExpressionMammalianMutation50AA deletion creating Progerin instead of mature…PromoterCMVAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
LV-hGFAP-SOX2-IRES-GFP
Plasmid#183909PurposeExpression of human SOX2 and GFP under the human GFAP ABC1D promoterDepositorAvailable sinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
prs316 CUP-GFP
Plasmid#128052PurposeYeast expression vector for N terminal GFP fusionsDepositorTypeEmpty backboneTagsGFPExpressionYeastAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1alpha-soCoChR-GFP
Plasmid#107709PurposeA somatic channelrhodopsin, which enables single cell, single millisecond resolution optogenetics. EF1alpha promoterDepositorInsertsoCoChR-GFP
UseAAVTagsEGFP and KA2ExpressionMammalianPromoterEF1alphaAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWZ194
Plasmid#163640Purposerps-27>DHB::2xmKate2-P2A-H2B::GFP expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome IDepositorInsertDHB::2mKate2-P2A-H2B::GFP::3xHA (his-58 Synthetic, Nematode)
UseCRISPRTags2xmKate2 and GFPExpressionWormPromoterrps-27Available sinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-CRY2-OCRL
Plasmid#79565Purposeexpression of GFP-tagged CRY2PHR fused to inositol 5-phosphatase domain of OCRLDepositorInsertOCRL (OCRL Human)
TagsCRY2 (photolyase homology region domain of Arabid…ExpressionMammalianMutationaa 234_539PromoterCMVAvailable sinceAug. 9, 2016AvailabilityAcademic Institutions and Nonprofits only