We narrowed to 5,485 results for: crispr cas9 grna plasmid
-
Plasmid#112458PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor SRFDepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pDEAF1.2.1-gDNA
Plasmid#112449PurposeCRISPR plasmid for expression of Cas9 nickase (D10A) and gRNA targeting human transcription factor DEAF1DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pE2F5.1.0-gDNA
Plasmid#112447PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor E2F5DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDLX1.1.0-gDNA
Plasmid#112439PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor DLX1DepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHBP1.1.0-gDNA
Plasmid#112432PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor HBP1DepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pATF1.1.0-gDNA
Plasmid#112424PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ATF1DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only