We narrowed to 5,485 results for: crispr cas9 grna plasmid
-
Plasmid#59928PurposegRNA for cleavage at rde-1(D801) locus in C elegansDepositorInsertrde-1(D801) gRNA
UseCRISPRAvailable SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJA45
Plasmid#59927PurposegRNA for cleavage at rde-1(D718) locus in C elegansDepositorInsertrde-1(D718) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUDP123
Plasmid#107269PurposepUDP123 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes OpADE2 and OpNIAD and Spcas9D147Y P411T in O. parapolymorpha (HH-gRNAOpADE2-HDV-linker-HH-gRNAOpNIAD-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting OpADE2 and NIAD in O. parapolymorpha
ExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_047
Plasmid#107145Purposemeasures Cas9 activityDepositorInsertGFP + sgRNA for GFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
AP568-3
Plasmid#70048Purposeco-expression of Cas9 and crRNA 589 target sequenceDepositorInsertsgRNA for dpy‐10
UseCRISPRExpressionWormAvailable SinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP568-2
Plasmid#70047Purposeco-expression of Cas9 and crRNA 589 target sequenceDepositorInsertsgRNA for dpy‐10
UseCRISPRExpressionWormAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_nat
Plasmid#184918PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_nat recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_hph
Plasmid#184919PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_hph recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only