We narrowed to 9,707 results for: crispr plasmids
-
Plasmid#184873PurposeChromosomal transfer helper plasmid with sgRNAs (one fixed, one flexible) for Vibrio natriegens genome editing protocol.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAbaMCi-GFP-gfp_pJMP2768
Plasmid#208889PurposeAcinetobacter baumannii CRISPRi test plasmid (GFP, gfp-targeting gRNA).DepositorInsertdCas9, sgRNA expression cassette, sfGFP
ExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFTK056
Plasmid#171328PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertSpCas9-NLS
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFTK063
Plasmid#171335PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertdSpCas9(m4) (for fusion)
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFTK062
Plasmid#171334PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertdSpCas9(m2) (for fusion)
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFTK061
Plasmid#171333PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertSpCas9 (for fusion)
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFTK057
Plasmid#171329PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertdSpCas9(m4)-VPR-NLS
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-Fluc-DR
Plasmid#242434PurposeFirefly Luciferse with a Direct Repeat sequence in the 3’UTR recognised by the CasRx under the control of the TRE3G promoter.DepositorInsertFirefly Luciferase
UseCRISPR and LuciferaseTagsCasRx Direct RepeatAvailable SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_YES_i2
Plasmid#231419PurposeThis YES-gate plasmid expresses dCas9 from a constitutive promoter, GFP from a promoter repressible by sgRNA-Y, and sgRNA-Y repressible by sgRNA-2.DepositorInsertsdCas9
GFP
sgRNA-Y
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only