We narrowed to 3,594 results for: cmv promoter
-
Plasmid#115137PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA2.1 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA2.1 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA3.1-NLS(sv40) (RTW2624)
Plasmid#115139PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA3.1 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA3.1 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA3-NLS(sv40) (BPK5077)
Plasmid#115140PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA3 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA3 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA2-NLS(sv40) (AAS2283)
Plasmid#115138PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA2 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA2 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV Luc2 (FF-Luciferase) R4-R3
Plasmid#62169PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and firefly luciferase module. Compatible with MultiSite Gateway cloningDepositorInsertLuciferase
UseLuciferase; Mule gateway entry vectorExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-CMVe-SCP1-TagBFP2-W3SL-BC(p1-10)
Plasmid#231354PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses TagBFP from SCP1 promoter and CMV enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eA3A-BE5-(NG)-PX458-EGFP
Plasmid#229687PurposeCRISPR CBE plasmid (C to T edits): eA3A-BE5-NG engineered to include the sgRNA cloning backbone from PX458 and EGFP. Includes BbsI sites for sgRNA cloning downstream of U6 promoter.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianAvailable SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hOrf2mor-NLS(sv40) (BPK5095)
Plasmid#115141PurposeCMV-T7 promoter expression plasmid for human codon optimized Orf2mor anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized Orf2mor anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailabilityAcademic Institutions and Nonprofits only -
EW499 CMV-TO-NZF-(GGS)x8[G1W S3D S6T G7L S9L G11M G14N G17D G19V G22W]-FRB(N2093W, T2098L)
Plasmid#236146PurposePlasmid encoding the NZF transcriptional activation domain attached by a deimmunized linker to FRB with N2093W and T098L mutations, under control of CMV promoter with two TetR binding sitesDepositorInsertNZF-deImmunLink-FRB
ExpressionMammalianMutationN2093W, T2098L in FRBPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-NF2-CFP
Plasmid#235687PurposeExpress CFP tagged NF2 gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SpCas9D10A nickase
Plasmid#216737PurposeExpresses SpCas9-D10A nickase from a CMVd1 promoter. For AAV packaging. Derived from pAAV-CMV-SpCas9 (Addgene #113034)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterCMVd1Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC592 - pCMV Mito-iRFP
Plasmid#59135PurposeA plasmid that express mitochondrial-targeted iRFP under the CMV promoter.DepositorInsertMitochondria-localized Infrared Fluorescent Protein
TagsMitochondria-targeting sequenceExpressionMammalianPromoterCMV-IEAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-V5-RFP-MST2
Plasmid#235688PurposeExpress RFP tagged MST2 gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC591 - pCMV Mem-iRFP
Plasmid#59134PurposeA plasmid that express membrane-targeted iRFP under the CMV promoter.DepositorInsertMembrane-localized Infrared Fluorescent Protein
TagsPalmitylation signalExpressionMammalianPromoterCMV-IEAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMMACE DEST CMV SpCas9
Plasmid#206268PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes SpCas9 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertSpCas9
UseCRISPR; Recombinant baculovirus productionExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
AP2u2-CMV-Ace2-IgG1
Plasmid#226455PurposeMammalian expression of human Ace2 protein under CMV promoter fused with IgG1, tagged with 6His, and released extracellular environment after expression for protein purificationDepositorInsertsAngiotensin Converting Enzyme 2
Immunoglobulin Heavy Constant Gamma 1
Tags6xHis TagExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1751 - pcDNA3.1 CMV-IE V5-ER-LBD
Plasmid#201818PurposeA plasmid expressing the ligand-binding domain of estrogen receptor with a V5 epitope tag from a CMV promoterDepositorInsertV5-ER-LBD
ExpressionMammalianPromoterCMV-IEAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMACE DEST CMV PE2
Plasmid#206276PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes PE2 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertPE2
UseCRISPR; Recombinant baculovirus production, multiā¦ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only