We narrowed to 5,485 results for: crispr cas9 grna plasmid
-
Plasmid#126901PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ OBfold
Plasmid#126889PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ HDT701
Plasmid#126898PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ ERF922
Plasmid#126893PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX601-GFP
Plasmid#84040PurposeStaphylococcus aureus (SaCas9) conjugated with GFPDepositorInsertSaCas9
UseAAV and CRISPRTagsNLS and T2A-EGFPExpressionMammalianPromoterCMVAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pROS13
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJA55
Plasmid#59935PurposegRNA for cleavage near sqt-1(e1350) locus in C elegansDepositorInsertsqt-1(e1350) gRNA2
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-mcBEST
Plasmid#209416PurposePlasmid for multiplexed cytosine base editing in streptomycetesDepositorInsertsCodon optimized APOBEC1-nCas9-UGI fusion protein
csy4 from Pseudomonas aeruginosa PAO1
UseCRISPR and Synthetic BiologyPromoterbase editing cassette: PtipA ; sgRNAs: PkasO* an…Available SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only