We narrowed to 13,184 results for: BASE

#87398

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87385

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#61361

encodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; mutation C1204R) driven by CMV promoter

Charles Gersbach

Hilton et al Nat Biotechnol. 2015 May;33(5):510-7. do

April 10, 2015

Academic Institutions and Nonprofits only

#61363

encodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inactivating mutation 1396/1397 SY/WW) driven by CMV promoter

Charles Gersbach

Hilton et al Nat Biotechnol. 2015 May;33(5):510-7. do

April 10, 2015

Academic Institutions and Nonprofits only