We narrowed to 14,509 results for: SHR
-
Plasmid#227445Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 24kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-20kb-USP
Plasmid#227446Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 20kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-11kb-USP
Plasmid#227447Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 11kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-7.5kb-USP
Plasmid#227448Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 7.5kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMCB320 sgControl (ACOCB)
Plasmid#228115PurposeSafe targeting sgRNADepositorInsertSafe targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMCB320 sgControl (GEA)
Plasmid#228144PurposeSafe targeting sgRNADepositorInsertSafe targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL639
Plasmid#231163PurposeT-DNA encoding TRV2 with mobile gRNAs targeting SlHAIRPLUS and SlAN2DepositorInsertmobile gRNAs targeting SlHAIRPLUS and SlAN2
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA355_sgCiPOLR2D
Plasmid#229022PurposeExpression of a CRISPRi doxycycline inducible guide targeting POLR2DDepositorInsertPOLR2D gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA052H_sgCh2
Plasmid#229023PurposeExpression of a EnAsCas12a control guide that cuts an intergenic region on chromosome 2DepositorInsertsgChr2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA052H_sgFOCAD #2
Plasmid#229024PurposeExpression of a EnAsCas12a guide targeting FOCADDepositorInsertFOCAD gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_051d_sgCiChr2-2
Plasmid#228940PurposeExpression of a CRISPRi control sgRNA that cuts an intergenic region on chromosome 2DepositorInsertsgChr2-2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo sgNon-targeting
Plasmid#233244PurposeKnock out - non targeting controlDepositorInsertnon targeting control sgRNA
UseLentiviralAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP_EHMT1V09
Plasmid#228813PurposeExpression of mouse EHMT1 with deletion of aa 1-31DepositorAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-1_NbATML1-2pro and NbATML1-1pro
Plasmid#231154PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNAs targeting NbATML1-2pro and NbATML1-1proDepositorInsertTREX2 and mobile gRNAs targeting NbATML1-2pro and NbATML1-1pro
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only