We narrowed to 25,556 results for: lars;
-
Plasmid#215266PurposeTU for the copper regulated expression of the flippase (FLP) recombinase.DepositorInsertCBS:miniDFR:FLP:TNOS
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB1203
Plasmid#215369PurposeTU for the expression of the silencing suppressor P19 driven by the 35s promoterDepositorInsert35s:P19:tNos
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKJ223
Plasmid#217497PurposeBacterial expression of BaFnuc guide RNADepositorInsertBaFnuc guide RNA scaffold
ExpressionBacterialAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKJ224
Plasmid#217496PurposeBacterial expression of BaFnuc for IVTTDepositorInsertBaFnuc
ExpressionBacterialAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM040_P8b_5'Ura4
Plasmid#216461Purpose5' homology arm for S. pombe genomic integration. Part type 8b following the YeastToolkit MoClo grammar.DepositorInsert5'ura4
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM036_P7_3"Ura4
Plasmid#216465Purpose3' homology arm for S. pombe genomic integration. Part type 7 following the YeastToolkit MoClo grammar.DepositorInsert3''ura4
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM024_P2_pMPA1
Plasmid#216449PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter mpa1
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM022_P2_pRPS1002
Plasmid#216447PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter rps1002
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM020_P2_pTRS1
Plasmid#216445PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter trs1
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM014_P2_pGPM1
Plasmid#216439PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter gpm1
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceMay 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
msFam160b1 (msFHIP2A) g1 lentiCRISPRv2-mCherry
Plasmid#218654PurposeKnockout vector for mouse Fam160b1 (Fhip2A)DepositorAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 msNLRP3(ΔPYD, I125M-END) (STOP)
Plasmid#218640PurposeGateway shuttling vector for cloning N-terminal NLRP3(ΔPYD, I125M-END) tags (contains a stop codon)DepositorAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 hNLRP3 R262W (disease-associated mutation)
Plasmid#218647PurposeGateway shuttling vector for cloning NLRP3-R262W (no stop codon)DepositorAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 msNLRP3(ΔPYD, I125M-END)
Plasmid#218641PurposeGateway shuttling vector for cloning N- and C-terminal NLRP3(ΔPYD, I125M-END) tags (contains no stop codon)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
msFam160b1 (msFHIP2A) g2 lentiCRISPRv2 mCherry
Plasmid#218655PurposeKnockout vector for mouse Fam160b1 (Fhip2A)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only