We narrowed to 10,139 results for: yeast
-
Plasmid#65339Purposeconstruction of ADH1 terminator in HCKan-P receiving vectorDepositorInsertADH1 terminator
UseSynthetic BiologyAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
HCKan-P-CYC1
Plasmid#65338Purposeconstruction of CYC1 promoter in HCKan-P receiving vectorDepositorInsertCYC1 promoter
UseSynthetic BiologyAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-Strep-Opa1 (SB251)
Plasmid#227600PurposeInducible expression of Strep-tagged Opa1 in Pichia pastorisDepositorInsertOPA1 (OPA1 Human)
TagsTwin-StrepTagExpressionYeastMutationcontains aa 253-960 onlyPromoterAOX1Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pre-Ost1-alphaf(I)-E2-Crimson
Plasmid#117661PurposeTest intracellular localisation of E2-Crimson and study the secretion efficiencyDepositorInsertpre-Ost1-alphaf(I)-E2-Crimson
ExpressionYeastMutationThis plasmid encodes the fluorescent protein E2-C…PromoterpAOX1Available SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pre-pro-alphaf(I)-E2-Crimson
Plasmid#117660PurposeTest intracellular localisation of E2-Crimson and study the secretion efficiencyDepositorInsertpre-pro-alphaf(I)-E2-Crimson
ExpressionYeastMutationThis plasmid encodes the fluorescent protein E2-C…PromoterpAOX1Available SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPing
Plasmid#47100PurposeExpresses the Ping open reading frame 1 (ORF1) and transposase from rice to allow mPing movement. The vector contains ORF1, transposase, mPing element and hph for hygromycin selection.DepositorInsertsPing cDNA
mPing
hygromycin resistance gene
UsePlant expressionTagsGFPExpressionYeastPromoterCaMV35s and StUbi3Available SinceSept. 16, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPICZ-pre-Ost1-alphaf(I)-Btl2
Plasmid#117667PurposeStudy secretion efficiency of Btl2DepositorInsertpre-Ost1-alphaf(I)-Btl2
ExpressionYeastMutationThis plasmid encodes the lipase Btl2 together wit…PromoterpAOX1Available SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYTRW22K_7Ti1
Plasmid#177293Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon with TcR and LacZDepositorInsertlacZ
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pM-TagRFP657
Plasmid#176563PurposeExpression of TagRFP657 for auxotrophic selection in the absence of methionineDepositorInsertTagRFP657
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[3]-C (LEU2)
Plasmid#177796PurposeGateway destination vector to insert genes of interest having a C-terminal DHFR F[3] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneTagsDHFR F[3]ExpressionYeastPromoterADH1Available SinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[1,2]-C (TRP1)
Plasmid#177795PurposeGateway destination vector to insert genes of interest having a C-terminal DHFR F[1,2] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneTagsDHFR F[1,2]ExpressionYeastPromoterADH1Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYTRW09K_0T5
Plasmid#177281Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with TcRDepositorInsertPtet-tetA(C)
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEW108
Plasmid#232823PurposeExpresses yeast compass complex in insect cellsDepositorInsertTagsHis6-3xFLAG, TwinstrepExpressionInsectMutationSet1(762-1080)Promoterpolyhedrin promoterAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYES1L-URA
Plasmid#84301PurposeE.coli shuttle vector for large-scale DNA assembly in S. cerevisiae.DepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTA-Mob 2.0 Tp
Plasmid#188619PurposeMutated pTA-Mob 2.0 Backbone in TraJ Promoter RegionDepositorTypeEmpty backboneUseSynthetic Biology; Conjugation helper plasmidExpressionBacterial and YeastAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYTRW26K_1Ti1
Plasmid#177292Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon/SacB with TcR and eYFPDepositorInsertPsacB-sacB
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSC5GGv1
Plasmid#194645PurposepSC5 Golden-Gate Cloning Plasmid (BsaI - Site 1)DepositorTypeEmpty backboneUseSynthetic Biology; Diatom expressionExpressionBacterial and YeastAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
yHS1-M7A,H102A
Plasmid#159152PurposeCytosolic labile heme reporterDepositorInsertyHS1-M7A,H102A
ExpressionYeastMutationMutated both Met 7 and His 102 of the cyt b562 mo…PromoterGPDAvailable SinceSept. 21, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only