We narrowed to 18,085 results for: gateway
-
Plasmid#70332PurposeGateway ORF clone of human E2F2 [NM_004091.3] without stop codon (for C-terminal fusions)DepositorInsertE2F2 (E2F2 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
8061-E05
Plasmid#234242PurposeGateway ORF Entry clone of human TGFBR2 iso 2 with stop codon (for native or N-terminal fusions)DepositorInsertTGFBR2 iso2 (TGFBR2 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMay 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
8061-E11
Plasmid#234248PurposeGateway ORF Entry clone of human SMAD5 with stop codon (for native or N-terminal fusions)DepositorInsertSMAD5 (SMAD5 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMay 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
8061-E16
Plasmid#234253PurposeGateway ORF Entry clone of human ACVR1 with stop codon (for native or N-terminal fusions)DepositorInsertACVR1 (ACVR1 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMay 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
8061-E18
Plasmid#234255PurposeGateway ORF Entry clone of human ACVR1B with stop codon (for native or N-terminal fusions)DepositorInsertACVR1B (ACVR1B Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMay 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
8061-E20
Plasmid#234257PurposeGateway ORF Entry clone of human ACVR1C with stop codon (for native or N-terminal fusions)DepositorInsertACVR1C (ACVR1C Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMay 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
8061-E21
Plasmid#234258PurposeGateway ORF Entry clone of human ACVR2A with stop codon (for native or N-terminal fusions)DepositorInsertACVR2A (ACVR2A Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMay 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
9336-E07
Plasmid#234302PurposeGateway ORF Entry clone of human TGFBR1 NDN to A with stop codon (for native or N-terminal fusions)DepositorInsertTGFBR1 NDN to A (TGFBR1 Human)
UseGateway entry cloneTagsExpressionMutationN267A/D269A/N270APromoterAvailable sinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
8061-E01
Plasmid#234239PurposeGateway ORF Entry clone of human TGFB1 with stop codon (for native or N-terminal fusions)DepositorInsertTGFB1 (TGFB1 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
8061-E24
Plasmid#234261PurposeGateway ORF Entry clone of human AMHR2 with stop codon (for native or N-terminal fusions)DepositorInsertAMHR2 (AMHR2 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
8061-E42
Plasmid#234279PurposeGateway ORF Entry clone of mouse Acvr1b with stop codon (for native or N-terminal fusions)DepositorInsertAcvr1b (Acvr1b Mouse)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
8061-E45
Plasmid#234282PurposeGateway ORF Entry clone of mouse Acvr2a with stop codon (for native or N-terminal fusions)DepositorInsertAcvr2a (Acvr2a Mouse)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
8522-E08
Plasmid#234293PurposeGateway ORF Entry clone of mouse Tgfbr1 with stop codon (for native or N-terminal fusions); N/267A/D269A/N270A mutationsDepositorInsertTgfbr1 N/267A/D269A/N270A (Tgfbr1 Mouse)
UseGateway entry cloneTagsExpressionMutationN/267A/D269A/N270APromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
9336-E05
Plasmid#234300PurposeGateway ORF Entry clone of human Tgfbr1 with stop codon (for native or N-terminal fusions); T204D mutationDepositorInsertTGFBR1 T204D (TGFBR1 Human)
UseGateway entry cloneTagsExpressionMutationT204DPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
9336-E06
Plasmid#234301PurposeGateway ORF Entry clone of human TGFBR1 with stop codon (for native or N-terminal fusions); K232R mutationDepositorInsertTGFBR1 K232R (TGFBR1 Human)
UseGateway entry cloneTagsExpressionMutationK232RPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
9336-E15
Plasmid#234303PurposeGateway ORF Entry clone of human TGFBR2 iso1 with stop codon (for native or N-terminal fusions)DepositorInsertTGFBR2 iso1 (TGFBR2 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR/hBIG1
Plasmid#226251PurposeEntry plasmid of hBIG1 for Gateway systemDepositorInsertBIG1 (ARFGEF1 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-hspa13
Plasmid#192730PurposeGateway entry vector encoding zebrafish hspa13DepositorInserthspa13 (hspa13 Zebrafish)
UseGateway entry vectorTagsExpressionMutationF48L (rs504983321)PromoterNoneAvailable sinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-dyrk1aa
Plasmid#192741PurposeGateway entry vector encoding zebrafish dyrk1aaDepositorInsertdyrk1aa (dyrk1aa Zebrafish)
UseGateway entry vectorTagsExpressionMutationPromoterNoneAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj6
Plasmid#192725PurposeGateway entry vector encoding zebrafish kcnj6DepositorInsertkcnj6 (kcnj6 Zebrafish)
UseGateway entry vectorTagsExpressionMutation5' insertion of ATGGCCAAGCTGACAGAATCC, ident…PromoterNoneAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only