We narrowed to 14,745 results for: RING
-
Plasmid#246280PurposeRab10 sensor acceptorDepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pAAV.hSynap.(ER).iGlucoSnFR2.HaloTag
Plasmid#244076PurposeER targeted expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNoRBP.iGlucoSnFR2.H348H.HaloTag
Plasmid#244108PurposeBacterial expression of green glucose sensor (high affinity) with inert HaloTagDepositorInsertiGlucoSnFR2.H348H.HaloTag
TagsHaloTagExpressionBacterialAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1004
Plasmid#239926PurposesgRNA compatible with TCTP-SynPro-07 and CaMV 35S-SynPro-12 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP994
Plasmid#239916PurposesgRNA-D compatible with TCTP-SynPro-01, TCTP-SynPro-16 and CaMV 35S-SynPro-11 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA-D
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1001
Plasmid#239923PurposesgRNA compatible with TCTP-SynPro-09 and CaMV 35S-SynPro-03 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1002
Plasmid#239924PurposesgRNA compatible with TCTP-SynPro-09 and CaMV 35S-SynPro-10 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP991
Plasmid#239913PurposesgRNA-A compatible with TCTP-SynPro-03, TCTP-SynPro-16 and CaMV 35S-SynPro-01 as Level-0 part (Goden Gate)DepositorInsertsgRNA-A
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP992
Plasmid#239914PurposesgRNA-B compatible with TCTP-SynPro-03, TCTP-SynPro-17 and CaMV 35S-SynPro-01 as Level-0 part (Goden Gate cloning)DepositorInsertsgRNA-B
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP993
Plasmid#239915PurposesgRNA-C compatible with TCTP-SynPro-01, TCTP-SynPro-17 and CaMV 35S-SynPro-11 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA-C
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP995
Plasmid#239917PurposesgRNA-E compatible with TCTP-SynPro-04, TCTP-SynPro-06 and CaMV 35S-SynPro-03 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA-E
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP996
Plasmid#239918PurposesgRNA compatible with TCTP-SynPro-05 and CaMV 35S-SynPro-15 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP997
Plasmid#239919PurposesgRNA compatible with TCTP-SynPro-05 and CaMV 35S-SynPro-07 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP999
Plasmid#239921PurposesgRNA compatible with TCTP-SynPro-08 and CaMV 35S-SynPro-04 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP998
Plasmid#239920PurposesgRNA compatible with TCTP-SynPro-06, TCTP-SynPro-13 and CaMV 35S-SynPro-10 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1000
Plasmid#239922PurposesgRNA compatible with TCTP-SynPro-08 and CaMV 35S-SynPro-04 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1007
Plasmid#239929PurposesgRNA compatible with TCTP-SynPro-04, TCTP-SynPro-11 and CaMV 35S-SynPro-08 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010C-Eco1
Plasmid#240690PurposeRSF1010 origin of replication plasmid containing Eco1 recombitron with a SapI flanked stuffer in the ncRNA expressed by J23115 constitutive promoterDepositorInsertEco1 RT, Eco1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only