We narrowed to 14,762 results for: RING
-
Plasmid#239913PurposesgRNA-A compatible with TCTP-SynPro-03, TCTP-SynPro-16 and CaMV 35S-SynPro-01 as Level-0 part (Goden Gate)DepositorInsertsgRNA-A
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP992
Plasmid#239914PurposesgRNA-B compatible with TCTP-SynPro-03, TCTP-SynPro-17 and CaMV 35S-SynPro-01 as Level-0 part (Goden Gate cloning)DepositorInsertsgRNA-B
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP993
Plasmid#239915PurposesgRNA-C compatible with TCTP-SynPro-01, TCTP-SynPro-17 and CaMV 35S-SynPro-11 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA-C
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP995
Plasmid#239917PurposesgRNA-E compatible with TCTP-SynPro-04, TCTP-SynPro-06 and CaMV 35S-SynPro-03 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA-E
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP996
Plasmid#239918PurposesgRNA compatible with TCTP-SynPro-05 and CaMV 35S-SynPro-15 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP997
Plasmid#239919PurposesgRNA compatible with TCTP-SynPro-05 and CaMV 35S-SynPro-07 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP999
Plasmid#239921PurposesgRNA compatible with TCTP-SynPro-08 and CaMV 35S-SynPro-04 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP998
Plasmid#239920PurposesgRNA compatible with TCTP-SynPro-06, TCTP-SynPro-13 and CaMV 35S-SynPro-10 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1000
Plasmid#239922PurposesgRNA compatible with TCTP-SynPro-08 and CaMV 35S-SynPro-04 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1007
Plasmid#239929PurposesgRNA compatible with TCTP-SynPro-04, TCTP-SynPro-11 and CaMV 35S-SynPro-08 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010C-Eco1
Plasmid#240690PurposeRSF1010 origin of replication plasmid containing Eco1 recombitron with a SapI flanked stuffer in the ncRNA expressed by J23115 constitutive promoterDepositorInsertEco1 RT, Eco1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCR197
Plasmid#240643PurposeExpression of the tri-cistronic construct NES-AmNeonGreen-P2A-mTurquoise2-NLS-T2A-mScarlet-I-PTS1 in Exaiptasia diaphana; In vitro transcription of the same construct via SP6 polymeraseDepositorInsertsAIPGENE865 promoter
SP6 promoter
AmNeonGreen
mTurquoise2
mScarlet-I
UseGene expression and genomic integration in fishTagsNES (from Exaiptasia diaphana MEK2), NLS (from SV…MutationCodon-optimized for Exaiptasia diaphana, amino ac…Available SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010-opEbu1
Plasmid#240702PurposeRSF1010 origin of replication plasmid containing Ebu1 recombitron with extended a1 a2 regions with a donor in the ncRNA targeting lacZ locus in Citrobacter freundii ATCC 8090 expressed by Pm promoterDepositorInsertEbu1 RT, Ebu1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationExtended a1 a2 regionsAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010-Abe1
Plasmid#240683PurposeRSF1010 origin of replication plasmid containing Abe1 recombitron with a SapI flanked stuffer in the ncRNA expressed by Pm promoterDepositorInsertAbe1 RT, Abe1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCh-CRY2-sspB2
Plasmid#223691PurposePhoBIT2 component; sspB2 (sspB mutant A56F) fused to mCh-CRY2PHRDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only