We narrowed to 31,496 results for: ica;
-
Plasmid#235475PurposeInducible gene VIII by Ptac promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK346
Plasmid#235477PurposeInducible gene VIII by Pbad promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK336
Plasmid#235476PurposeInducible gene VIII by Plux promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK-cinI
Plasmid#235486PurposeInducible gene cinI for OC14-HSL production by Ptac promoterDepositorInsertcinI
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYihI-N-term S-A
Plasmid#233096PurposeExpression of GST-YihI with N-term serines (S) mutated to alanine (A)DepositorInsertYihI with N-term serines (S) mutated to alanine (A)
TagsGSTExpressionBacterialMutationN-term serines (S) mutated to alanine (A)Available SinceMay 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
ADEPT-pTarget-tetR
Plasmid#238043PurposeModified ADEPT-pCas9 with sfGFP under TtrB promoter for tetrathionate (TTR) sensing.DepositorInsertsfGFP
UseSynthetic BiologyPromoterttrBAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.3QS
Plasmid#235485Purposeinducible NOT gate receiver with bs for sgRNA3DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.23
Plasmid#235484Purposedual NOT gate receiver with bs for sgRNA2 and sgRNA3DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK302.6
Plasmid#235471PurposeMessage phagemid carrying sgRNA6 (prom. J23110, backbone pBR322)DepositorInsertsgRNA6
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK052.3
Plasmid#235472PurposeMessage phagemid carrying sgRNA3 (prom. J23119, backbone RSF1030)DepositorInsertsgRNA3
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.1
Plasmid#235460PurposeMessage phagemid carrying sgRNA1 (prom. J23119, backbone pBR322)DepositorInsertsgRNA1
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.2
Plasmid#235461PurposeMessage phagemid carrying sgRNA2 (prom. J23119, backbone pBR322)DepositorInsertsgRNA2
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.3
Plasmid#235462PurposeMessage phagemid carrying sgRNA3 (prom. J23119, backbone pBR322)DepositorInsertsgRNA3
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.4
Plasmid#235463PurposeMessage phagemid carrying sgRNA4 (prom. J23119, backbone pBR322)DepositorInsertsgRNA4
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.5
Plasmid#235464PurposeMessage phagemid carrying sgRNA5 (prom. J23119, backbone pBR322)DepositorInsertsgRNA5
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.6
Plasmid#235465PurposeMessage phagemid carrying sgRNA6 (prom. J23119, backbone pBR322)DepositorInsertsgRNA6
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK302.1
Plasmid#235466PurposeMessage phagemid carrying sgRNA1 (prom. J23110, backbone pBR322)DepositorInsertsgRNA1
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only