We narrowed to 12,288 results for: shRNA
-
Plasmid#208424PurposeLentiviral gRNA plasmid targeting human RIPK3 gene, co-expression of BFP tagDepositorInsertRIPK3 (Ripk3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hRIPK3_2b)-PGKpuro2ABFP-W
Plasmid#208425PurposeLentiviral gRNA plasmid targeting human RIPK3 gene, co-expression of BFP tagDepositorInsertRIPK3 (Ripk3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hTNF_2b)-PGKpuro2ABFP-W
Plasmid#208426PurposeLentiviral gRNA plasmid targeting human TNF gene, co-expression of BFP tagDepositorInsertTNF (TNF Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPTPN11_1k)-PGKpuro2ABFP-W
Plasmid#208427PurposeLentiviral gRNA plasmid targeting human PTPN11 gene, co-expression of BFP tagDepositorInsertPTPN11 (PTPN11 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPTPN11_2b)-PGKpuro2ABFP-W
Plasmid#208428PurposeLentiviral gRNA plasmid targeting human PTPN11 gene, co-expression of BFP tagDepositorInsertPTPN11 (PTPN11 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMAP3K7_1k)-PGKpuro2ABFP-W
Plasmid#208412PurposeLentiviral gRNA plasmid targeting human MAP3K7 gene, co-expression of BFP tagDepositorInsertMAP3K7 (MAP3K7 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMAP3K7_2m)-PGKpuro2ABFP-W
Plasmid#208413PurposeLentiviral gRNA plasmid targeting human MAP3K7 gene, co-expression of BFP tagDepositorInsertMAP3K7 (MAP3K7 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
lenti-hygro-Mouse-sgDdx6-1
Plasmid#240003PurposeExpresses Mouse sgDdx6 in mammalian cellsDepositorInsertsgDdx6
UseLentiviralAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-puro-hANKRD11 (exon 5-1)
Plasmid#236612PurposeKnockouts ANKRD11 in human cellsDepositorAvailable SinceJune 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA378 - pBA904 Puro-T2A-GFP CD45 CRISPRa guide 3 (pRCA360 backbone)
Plasmid#238169PurposeLentiviral CRISPR guide vector expressing PTPRC targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-NPM1-gRNA for HCT116
Plasmid#238249PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to NPM1 locusDepositorInsertNPM1
UseCRISPRAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-puro-mAnkrd11 (intron 3)
Plasmid#236608PurposeKnockouts Ankrd11 in mouse cellsDepositorAvailable SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)-mRuby2
Plasmid#215447PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorTagsmRuby2MutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPB.DEST-ITGB1(YYFF)-mRuby2
Plasmid#215449PurposePiggybac expression vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseTransposon-based stable expressionTagsmRuby2ExpressionMammalianMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoterCAGAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-hSyn-mCherry-Rorb sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239029PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Satb2 sesRNA-2a-msFlag-2a-tTA-WPRE
Plasmid#239028PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMCB320 sgControl (ACOCB)
Plasmid#228115PurposeSafe targeting sgRNADepositorInsertSafe targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMCB320 sgControl (GEA)
Plasmid#228144PurposeSafe targeting sgRNADepositorInsertSafe targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only