We narrowed to 31,496 results for: ica;
-
Plasmid#217671PurposeFor expression of SUMO tagged human beta A4 crystallinDepositorAvailable SinceMay 11, 2024AvailabilityAcademic Institutions and Nonprofits only
-
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Efg1-ΔDBD
Plasmid#216396PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1DepositorInsertEfg1-ΔDBD
Tags6xHis-tagsExpressionBacterialMutationdeleted amino acids 182-356Available SinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Efg1-DBD
Plasmid#216399PurposeExpresses 6xHis-tagged DBD of Efg1DepositorInsertEfg1-DBD
Tags6xHis-tagsExpressionBacterialMutationdeleted amino acids 2-181 and 357-554Available SinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
T7-LacO-Halo-RGD-STReTCh (Force Inert)
Plasmid#216710PurposeExpresses HaloTag-RGD-STReTCh Force Inert Control in bacteriaDepositorInsertHaloTag-RGD-STReTCh
Tags6xHis and HaloTagExpressionBacterialAvailable SinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Fg vector
Plasmid#213464PurposeDestination vector for cloning and transformation into TSI locus 1.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-NFKB1-PGK-EGFP
Plasmid#204018PurposeHomologous donor template for NFKB1 knockout expressing EGFPDepositorInsertEGFP
UseCRISPRExpressionMammalianPromoterPGKAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-NFKB1-PGK-tdTomato
Plasmid#204019PurposeHomologous donor template for NFKB1 knockout expressing tdTomatoDepositorInserttdTomato
UseCRISPRExpressionMammalianPromoterPGKAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-NFKB2-PGK-EGFP
Plasmid#204020PurposeHomologous donor template for NFKB2 knockout expressing EGFPDepositorInsertEGFP
UseCRISPRExpressionMammalianPromoterPGKAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-NFKB2-PGK-tdTomato
Plasmid#204021PurposeHomologous donor template for NFKB2 knockout expressing tdTomatoDepositorInserttdTomato
UseCRISPRExpressionMammalianPromoterPGKAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only