We narrowed to 19,081 results for: cat
-
Plasmid#129475Purpose3rd-generation lentiviral vector for hUbC-driven co-expression of EGFP and truncated C3DepositorInserttruncated (AA173-201) exoenzyme C3 from C. botulinum, P2A, EGFP
UseLentiviralExpressionMammalianPromoterhuman ubiquitin CAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSilencer2.1-U6-3JB1R+6
Plasmid#190842PurposeFor mammalian expression of 3JB1R+6, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB1R_AP3+6bp (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-4JC1RR
Plasmid#190847PurposeFor mammalian expression of 4JC1RR, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert4JC1RR (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-LRS1F50C
Plasmid#190856PurposeFor mammalian expression of LRS1F50C, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer is regulated by riboswitch elements.DepositorInsertLRS1F50C (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-T1-U6-AP3
Plasmid#190828PurposeFor mammalian expression of T1 and AP3, the RNA aptamers of ncOGT and GFP, respectively. Expression of each aptamer is driven by a U6 promoter.DepositorInsertsT1 (an RNA aptamer of OGT)
AP3 (an RNA aptamer of GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-NL1F35
Plasmid#190830PurposeFor mammalian expression of NL1F35, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a flexible linker.DepositorInsertNL1F35 (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-NL1F50
Plasmid#190831PurposeFor mammalian expression of NL1F50, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a flexible linker.DepositorInsertNL1F50 (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-3JB1F+2
Plasmid#190833PurposeFor mammalian expression of 3JB1F+2, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB1F_T1+2bp (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-3JB1F+6
Plasmid#190835PurposeFor mammalian expression of 3JB1F+6, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB1F_T1+6bp (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pENTR1A hu_ncOGT WT (open N-term)
Plasmid#155197PurposeEntry vector encoding non-tagged O-GlcNAc Transferase with open N-terminusDepositorInsertO-GlcNAc Transferase (OGT Human)
UseGateway CloningMutationWT OGT with no start codon, in-frame with gateway…Available SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ Zf cdh1-deltaCyot-GFP
Plasmid#185412PurposeGFP tagged zebrafish cdh1 lacking the cytoplasmic domain.DepositorInsertcdh1 (cdh1 Zebrafish)
UseIn vitro synthesis of mrnaTagseGFPExpressionMammalianMutationCytoplasmic domain deletedAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgFbxw7#1/Cre
Plasmid#173635PurposeExpresses a Fbxw7-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Fbxw7 (Fbxw7 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP650
Plasmid#135000PurposeVP64-m6A Reader. Activates transcription near Gm6ATC sites. pUBC-DpnI(aa146-254)-VP64-V5 pGK-ZeoRDepositorInsertpUBC-DpnI(aa146-254)-VP64-V5 pGK-ZeoR
UseLentiviral and Synthetic BiologyTagsDpnI(aa146-254), V5 tag, and VP-64ExpressionMammalianMutationDpnI truncated to aa146-254Available SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
TOMM20-mTurquoise-RhoA-G14V-deltaCaaX
Plasmid#176123PurposeConstitutively active, mitochondrial localized RhoADepositorAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-squirrel-monkey-CHMP3(155)-HA
Plasmid#154173Purposeexpresses squirrel monkey CHMP3(155) in mammalian cellsDepositorInsertCHMP3(155)
TagsHAExpressionMammalianMutationC-terminal truncation of CHMP3 at amino acid 155PromoterEF1-alphaAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR: pmU6 sgChr13q34 2xMS2 pUbC MCP-mCherry-p2a-Puro
Plasmid#174119PurposeExpression of sgRNA targeting Chr13q34 (chr13: 112277011 - 112319170, hg38)DepositorInsertsgChr13q34 2xMS2 and MCP-mCherry-p2a-Puro
UseLentiviralPromotermU6 and UbCAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.V5.HA_NGFR
Plasmid#158339PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.V5.HAMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.AU1.VSVg_NGFR
Plasmid#158351PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.AU1.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.AU1.C_NGFR
Plasmid#158314PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.AU1.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only