We narrowed to 43,031 results for: gats
-
Plasmid#235459PurposeNOR gate receiver with bs for sgRNA2 and sgRNA3DepositorInsertNOR gate
UseSynthetic BiologyAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK506.4
Plasmid#235455PurposeBUF/YES gate receiver with bs for sgRNA2DepositorInsertYES/BUF gate
UseSynthetic BiologyAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK506.5
Plasmid#235456PurposeBUF/YES gate receiver with bs for sgRNA3DepositorInsertYES/BUF gate
UseSynthetic BiologyAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK507
Plasmid#235457PurposeOR/NAND gate receiver with bs for sgRNA2 and sgRNA3DepositorInsertOR gate
UseSynthetic BiologyAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.3QS
Plasmid#235485Purposeinducible NOT gate receiver with bs for sgRNA3DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.23
Plasmid#235484Purposedual NOT gate receiver with bs for sgRNA2 and sgRNA3DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.1
Plasmid#235449PurposeNOT gate receiver with binding site (bs) for sgRNA1DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.2
Plasmid#235450PurposeNOT gate receiver with bs for sgRNA2DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.3
Plasmid#235451PurposeNOT gate receiver with bs for sgRNA3DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.4
Plasmid#235452PurposeNOT gate receiver with bs for sgRNA4DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.5
Plasmid#235453PurposeNOT gate receiver with bs for sgRNA5DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.6
Plasmid#235454PurposeNOT gate receiver with bs for sgRNA6DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
L1p6_barley_sgRNA_scaffold
Plasmid#231033PurposeCloning vector to clone sgRNA in scaffold under TaU6 promoter for Cas9 mediated CRISPR for goldengate level1 position 6DepositorInsertScaffold for Cas9 mediated CRISPR
UseCRISPRExpressionBacterialPromoterTaU6Available SinceMarch 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
L1p5_barley_sgRNA_scaffold
Plasmid#231032PurposeCloning vector to clone sgRNA in scaffold under TaU6 promoter for Cas9 mediated CRISPR for goldengate level1 position 5DepositorInsertScaffold for Cas9 mediated CRISPR
UseCRISPRExpressionBacterialPromoterTaU6Available SinceMarch 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
L1p4_barley_sgRNA_scaffold
Plasmid#231031PurposeCloning vector to clone sgRNA in scaffold under TaU6 promoter for Cas9 mediated CRISPR for goldengate level1 position 4DepositorInsertScaffold for Cas9 mediated CRISPR
UseCRISPRExpressionBacterialPromoterTaU6Available SinceMarch 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
L1p3_barley_sgRNA_scaffold
Plasmid#231030PurposeCloning vector to clone sgRNA in scaffold under TaU6 promoter for Cas9 mediated CRISPR for goldengate level1 position 3DepositorInsertScaffold for Cas9 mediated CRISPR
UseCRISPRExpressionBacterialPromoterTaU6Available SinceMarch 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
JDW 1035 (pME_V5_TCF7L1_P2A_H2A_mCherry)
Plasmid#232125PurposeA middle entry gateway clone containing V5 tagged human TCFL7 / TCF3 and an H2A tagged mCherry, separated by a P2A peptide cleavage sequence.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET26b(modified)-T-Lg
Plasmid#216977PurposeExpression of GvpT-Linker-Large BiTDepositorInsertGvpT-Linker-Large BiT
TagsSplit Nanoluciferase LargeBiT-FLAGExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaBSU
Plasmid#216953PurposeMega' with knockout of GvpB, GvpS and GvpUDepositorInsertMega' with knockout of GvpB, GvpS and GvpU
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only