We narrowed to 16,183 results for: nes
-
Plasmid#23072DepositorPublicationInsertyeast Histone H3-2 and Histone H4-2
ExpressionYeastMutationHistone H3 changed Lysine 14 to Glutamine, H3 K14…Available sinceMarch 3, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWZ414-F50
Plasmid#23074DepositorPublicationInsertyeast Histone H3-2 and Histone H4-2
ExpressionYeastMutationHistone H3 changed Lysine 14 to Arginine, H3 K14R…Available sinceFeb. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWZ414-F54
Plasmid#23078DepositorPublicationInsertyeast Histone H3-2 and Histone H4-2
ExpressionYeastMutationHistone H3 changed Lysine 9 to Glutamine, H3 K9Q …Available sinceFeb. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
AP70_pU.CAG.Cas9-D10A-K848A-R1060A.rBGpA
Plasmid#199254PurposeExpression construct encoding the high specificity SpCas9-KARA-D10A nickaseDepositorInsertHigh specificity S. pyogenes Cas9-D10A-KARA nickase
UseCRISPRTags3XFLAG epitope, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianMutationD10A K848A R1060APromoterCAG promoterAvailable sinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVH333-1-Tier1-PhCMV-dCas9-3xNLS-VP64
Plasmid#169597PurposeTier-1 vector encoding PhCMV-driven dCas9-3xNLS-VP64 expression (PhCMV-dCas9-3xNLS-VP64-pA).DepositorInsertdead S.pyogenes Cas9 - VP64 fusion
ExpressionMammalianPromoterPhCMVAvailable sinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET26b(+)-SpnA_90-876_C to S
Plasmid#259974PurposeExpresses SpnA mutant C729SDepositorInsertnuclease A
Tags6xHis-HA-StrepII-TEV (histidine–hemagglutinin–Str…ExpressionBacterialMutationChanged Cysteine 729 to Serine and truncated SpnA…PromoterT7 PromoterAvailable sinceSept. 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
p_sc-eVIP-delta-Puro-EGFP-GNAS
Plasmid#249456PurposeTransfer plasmid for stable transgene expression with 2nd or 3rd generation lentiviral systemsDepositorAvailable sinceJune 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBBK09 pCAS-Tyr-[gRNA: BsaI GFP dropout] (BsmBI-flanked URA3, AmpR)
Plasmid#178993PurposeSp.Cas9 and gRNA yeast expression vector for HDR-based gRNA introduction. Selection = URA3DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJCC_163 SpCas9 K233A/K234A/K253A/K263A
Plasmid#179527PurposeFor bacterial expression of SpCas9 K233A/K234A/K253A/K263A (helix-rolling basic patch mutant) with an N-terminal His-MBP tagDepositorInsertSpCas9 K233A/K234A/K253A/K263A
Tags10X His, TEV protease cleavage site, and maltose-…ExpressionBacterialMutationchanged lysines 233, 234, 253, and 263 to alanineAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
p_sc-eVIP-delta-Puro-EGFP-GNAS-R201H
Plasmid#249457PurposeTransfer plasmid for stable transgene expression with 2nd or 3rd generation lentiviral systemsDepositorAvailable sinceJune 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCri-H6-TEV-GRAB
Plasmid#128498PurposeExpresses GRAB (from V34 to N181) (Streptococcus pyogenes serotype M1) in bacterial cells. With N-t H6x tag + TEV.DepositorInsertGRAB (Streptococcus pyogenes serotype M1) (grab Streptococcus pyogenes serotype M1)
TagsHis tag (6x)ExpressionBacterialPromoterT7Available sinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJSC119 - Bacterial expression plasmid for SpCas9 + N497A/R661A/Q695A variant
Plasmid#101207PurposeBacterial expression plasmid for SpCas9 + N497A/R661A/Q695A variantDepositorInsertSpCas9 variant N497A/R661A/Q695A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationN497A, R661A and Q695APromoterT7Available sinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJSC052 - Bacterial expression plasmid for SpCas9, REC3 FRET variant
Plasmid#101201PurposeBacterial expression plasmid for SpCas9, REC3 FRET variantDepositorInsertSpCas9 variant C80S/C574S/S701C/S960C
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S701C and S960CPromoterT7Available sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJSC033 - Bacterial expression plasmid for SpCas9, REC2 FRET variant
Plasmid#101200PurposeBacterial expression plasmid for SpCas9, REC2 FRET variantDepositorInsertSpCas9 variant C80S/C574S/E60C/D273C
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, E60C and D273CPromoterT7Available sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJSC077 - Bacterial expression plasmid for SpCas9 + K855A, HNH FRET variant
Plasmid#101214PurposeBacterial expression plasmid for SpCas9 + K855A, HNH FRET variantDepositorInsertSpCas9 variant C80S/C574S/S355C/S867C/K855A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S355C, S867C and K855APromoterT7Available sinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJSC115 - Bacterial expression plasmid for SpCas9-HF1, HNH FRET variant
Plasmid#101210PurposeBacterial expression plasmid for SpCas9-HF1, HNH FRET variantDepositorInsertSpCas9 variant C80S/C574S/S355C/S867C/N497A/R661A/Q695A/Q926A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S355C, S867C, N497A, R661A, Q695A an…PromoterT7Available sinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJSC038 - Bacterial expression plasmid for SpCas9∆REC3, HNH FRET variant
Plasmid#101203PurposeBacterial expression plasmid for SpCas9∆REC3, HNH FRET variantDepositorInsertSpCas9 variant C80S/C574S/S355C/S867C/M1–N497,GGS,V713–D1368
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S355C, S867C, M1-N497, GGS, V713-D13…PromoterT7Available sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJSC131 - Bacterial expression plasmid for SpCas9-HF1, REC3 FRET variant
Plasmid#101212PurposeBacterial expression plasmid for SpCas9-HF1, REC3 FRET variantDepositorInsertSpCas9 variant C80S/C574S/S701C/S960C/N497A/R661A/Q695A/Q926A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S701C, S960C, N497A, R661A, Q695A an…PromoterT7Available sinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only