We narrowed to 14,762 results for: RING
-
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
mC4-GFP
Plasmid#221339PurposeExpresses murine homolog of complement 4 fused with GFP under CAG promoterDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-1
Plasmid#177781PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-2
Plasmid#177782PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-Sema7A-ΔSEMA
Plasmid#190647PurposeExpresses Mouse Sema7A with SEMA domain deletedDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-Sema7A-ΔIG
Plasmid#190648PurposeExpresses Mouse Sema7A with IG Domain DeletedDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-Sema7A-ΔPSI
Plasmid#190649PurposeExpresses Mouse Sema7A with PSI domain deletedDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-Sema7A-KCE
Plasmid#190651PurposeExpresses Mouse Sema7A with RGD motif mutated to KCEDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-sp-myc-hSema4D
Plasmid#190654PurposeExpresses Human Sema4D with N terminal myc after signal peptideDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ Zf nhsl1b-mNeongreen
Plasmid#233883PurposemNeongreen tagged form of zebrafish nhsl1b. For in vitro transcription (SP6) or expression through CMV.DepositorInsertnhsl1b (nhsl1b Zebrafish)
UseIn vitro synthesis of mrnaTagsmNeongreenExpressionMammalianAvailable SinceJuly 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW428 CMV-TO-ZNF35(5-8)-ZNF35(5-8)-deImmLink-ZIK1KRAB
Plasmid#236141PurposePlasmid encoding the ZNF35/ZNF35 zinc finger array attached by a deimmunized linker to the ZIK1 KRAB domain, under control of CMV promoter with two TetR binding sitesDepositorInsertZNF35(5-8)-ZNF35(5-8)-deImmunLink-ZIK1KRAB
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW265 SFFV-mCherry-SGc(stem-1(3xPUF9R-tar))cSG-EGFP (FLP-IN)
Plasmid#236124PurposePlasmid encoding fluorescent reporter for PUF-9R binding which expresses mCherry constitutively and EGFP upon stop codon deamination due to ADAR-PUF9R bindingDepositorInsertmCherry-SGc(stem-1(3xPUF9R-tar))cSG-EGFP
ExpressionMammalianPromoterSFFVAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW152 CMV-TO-Gal4-NZF[Mutated Linkers] (FLP-IN)
Plasmid#236123PurposePlasmid encoding Gal4-NZF transcription factor with deimmunized linkers between the component domains of NZF, under control of CMV promoter with two TetR binding sitesDepositorInsertGal4-NZF (mutated linkers)
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW408 (ZNF35tar-compact)x8-H2B-GFP
Plasmid#236129PurposeFuorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with eight ZNF35 binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with eight ZNF35 binding sit…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW369 CMV-TO-ZNF35(5-8)-ZNF250(1-4)-deImmunLink-NZF(FLP-IN)
Plasmid#236145PurposePlasmid encoding the ZNF35/ZNF250 zinc finger array attached by a deimmunized linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertZNF35(5-8)-ZNF250(1-4)-deImmunLink-NZF
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW490 CMV-TO-UTRN-14ZF-realdeImmLink-NZF (FLP-IN)
Plasmid#236149PurposePlasmid encoding the UTRN-14 zinc finger array attached by a deimmunized linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertUTRN-14ZF-deImmLink-NZF
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW409 ZNF250tarv3 x8-H2B-GFP
Plasmid#236133PurposeFuorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with eight ZNF250 binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with eight ZNF250 binding si…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
SCN1Aprom(1-500)-H2B-GFP
Plasmid#236162PurposeFluorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with the SCN1a promoter region encompassing 500 bp upstream of its transcriptional start siteDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with the SCN1a promoter regi…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only