We narrowed to 7,692 results for: Lif;
-
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-canis_PTGS2-4
Plasmid#184730PurposeCOX2-KO in MDCKDepositorInsertA gRNA targeting the dog COX2 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-homo_PLA2G4A-1
Plasmid#184735PurposecPLA2-KO in HeLaDepositorInsertA gRNA targeting the human cPLA2 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-homo_PLA2G4A-2
Plasmid#184736PurposecPLA2-KO in HeLaDepositorInsertA gRNA targeting the human cPLA2 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-OptoSTIM1(CRY2clust)
Plasmid#184715PurposeOptoSTIM1(CRY2clust)DepositorInsertOptoSTIM1
ExpressionMammalianAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-EBFP2-OptoSTIM1(CRY2clust)
Plasmid#184716PurposeOptoSTIM1(CRY2clust)DepositorInsertOptoSTIM1
ExpressionMammalianAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-PTGER2
Plasmid#184721PurposeExogenous EP2DepositorInsertPTGER2 (PTGER2 Human, Synthetic)
ExpressionMammalianAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-bleo-COX1-4
Plasmid#184722PurposeCOX1-KO in MDCKDepositorInsertA gRNA targeting the dog COX1 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-hyg2-COX2-4
Plasmid#184723PurposeCOX2-KO in MDCKDepositorInsertA gRNA targeting the dog COX2 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-bleo-PTGER2
Plasmid#184724PurposeEP2-KO in MDCKDepositorInsertA gRNA targeting the dog EP2 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only