We narrowed to 18,068 results for: She
-
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pRDA355_sgCiPOLR2D
Plasmid#229022PurposeExpression of a CRISPRi doxycycline inducible guide targeting POLR2DDepositorInsertPOLR2D gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA052H_sgCh2
Plasmid#229023PurposeExpression of a EnAsCas12a control guide that cuts an intergenic region on chromosome 2DepositorInsertsgChr2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA052H_sgFOCAD #2
Plasmid#229024PurposeExpression of a EnAsCas12a guide targeting FOCADDepositorInsertFOCAD gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_051d_sgCiChr2-2
Plasmid#228940PurposeExpression of a CRISPRi control sgRNA that cuts an intergenic region on chromosome 2DepositorInsertsgChr2-2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-HRAS(GV12)
Plasmid#233181PurposeRetroviral expression of HRAS(G12V)DepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-Isl1-P2A-mRuby2
Plasmid#233169PurposeRetroviral expression of Isl1 with mRuby2 fluorescent reporterDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-mLhx3-P2A-mRuby2
Plasmid#233175PurposeRetroviral expression of mLhx3 with mRuby2 fluorescent reporterDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-mNgn2x3HA-P2A-mRuby2
Plasmid#233157PurposeRetroviral expression of Ngn2x3HA with mRuby2 fluorescent reporterDepositorInsertmNgn2x3HA-P2A-mRuby2 (Neurog2 Mouse, Synthetic)
UseRetroviralTagsx3HAExpressionMammalianAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-Isl1-P2A-mRuby2
Plasmid#233158PurposeRetroviral expression of Isl1 with mRuby2 fluorescent reporterDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-mLhx3-P2A-mRuby2
Plasmid#233159PurposeRetroviral expression of mLhx3 with mRuby2 fluorescent reporterDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-mNgn2x3HA-P2A-mRuby2
Plasmid#233163PurposeRetroviral expression of Ngn2x3HA with mRuby2 fluorescent reporterDepositorInsertmNgn2x3HA-P2A-mRuby2 (Neurog2 Mouse, Synthetic)
UseRetroviralTagsx3HAExpressionMammalianAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-Puro-DEST (JDW 925)
Plasmid#229808PurposeA puromycin selectable, PiggyBac destination vector compatible with 4-way multi-site gateway cloning systemDepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only