We narrowed to 7,880 results for: Lif
-
Plasmid#241793PurposeExpression vector for mouse Pgc-1alpha with EYFPDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only
-
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-cOpn5-T2A-EGFP
Plasmid#237858PurposeThe transfer plasmid for packaging AAV expressing Cre-dependent chicken OPN5 was constructed by inserting the OPN5 coding sequence into the multiple cloning site under the control of EF1α promoterDepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-cOpn5-T2A-mcherry
Plasmid#238009PurposeThe transfer plasmid for packaging AAV expressing Cre-dependent chicken OPN5 was constructed by inserting the OPN5 coding sequence into the multiple cloning site under the control of EF1α promoterDepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-pSyn_R-PTEN
Plasmid#227437PurposeExpression of the R-PTEN sensor under the Synapsin promoter in an AAV backboneDepositorInsertR-PTEN sensor (Pten Rat)
UseAAVTagsmCyRFP2 and mMaroonExpressionMammalianMutationR14GPromoterSynapsinAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-mNgn2x3HA-T2A-Isl1
Plasmid#233161PurposeRetroviral expression of mNgn2x3HA and Isl1DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-Isl1-T2A-mLhx3
Plasmid#233160PurposeRetroviral expression of Isl1 and Lhx3 for motor neuron specificationDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-mNgn2x3HA-T2A-mLhx3
Plasmid#233162PurposeRetroviral expression of mNgn2x3HA and Lhx3DepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HA-GTSE1-S91, 262 ,331, 724A
Plasmid#224738PurposeFor expression of HA-tagged GTSE1 protein with S91, 262 ,331, 724A mutationDepositorInsertGTSE1 (GTSE1 Human)
TagsHAExpressionMammalianMutationSerine 91, 262 ,331, 724 to AlaninePromoterCMVAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 KBTBD4 P311PP
Plasmid#184628PurposeMammalian expression vector with N-terminal 3xFlag for KBTBD4 P311PP expression in mammalian cellsDepositorInsertN-terminal 3xFlag tagged KBTBD4 P311PP (KBTBD4 Human)
ExpressionMammalianMutationP311PPPromoterCMVAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only