We narrowed to 30,936 results for: LIS;
-
Plasmid#109366PurposeHuman rod opsin chimera with intracellular loop 3 replaced by intracellular loop 2 of mGluR6 with 1D4 tagDepositorInsertTags1D4ExpressionMammalianPromoterCMVAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pTH742-CEN-RLuc/slowminCFLuc
Plasmid#38222DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
KTK_219
Plasmid#180534PurposeEntry vector containing K.rhaeticus native promoter pCmcAX (bcs1) (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pCmcAX (bcs1) (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_223
Plasmid#180538PurposeEntry vector containing K.rhaeticus native promoter pHxu (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pHxu (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_226
Plasmid#180552PurposeEntry vector containing K.rhaeticus native promoter pRutB (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pRutB (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_218
Plasmid#180533PurposeEntry vector containing K.rhaeticus native promoter pTtaC (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pTtaC (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_225
Plasmid#180539PurposeEntry vector containing K.rhaeticus native promoter pBlh (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pBlh (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_221
Plasmid#180536PurposeEntry vector containing K.rhaeticus native promoter pKr0953 (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pKr0953 (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_220
Plasmid#180535PurposeEntry vector containing K.rhaeticus native promoter pAacsAB4 (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pAacsAB4 (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_222
Plasmid#180537PurposeEntry vector containing K.rhaeticus native promoter pCyd (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pCyd (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBEST-p70b-UTR1-NTerm 6xHis-zmADH-T500
Plasmid#92229PurposeExpression of zmADH using the p70b (weak version of the p70a promoter) promoter and UTR1DepositorInsertNTerm 6xHis Tagged zmADH
UseSynthetic Biology; Cell free protein synthesis (c…Tags6xHisExpressionBacterialPromoterp70b (p70a promoter with one mutation)Available SinceJune 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Kif1bβ-pcDNA3
Plasmid#22534DepositorAvailable SinceDec. 3, 2009AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-AKAP95-FRB
Plasmid#138254PurposeFull-length AKAP95 fused to FRB (rapamycin-binding domain). Used in conjunction with pcDNA3-FKBP-ICUE3-NLS to monitor cAMP dynamics within AKAP95 nanodomain.DepositorInsertAKAP95-FRB (AKAP8 Human)
TagsFRB rapamycin binding domain and HA epitopeExpressionMammalianPromoterCMVAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP10-AAV-U6/TO-gRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82706PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PARP1-3xFlag-7xKQ
Plasmid#111576PurposeExpresses full length PARP1 with K to Q mutations in automodification domain in mammalian cellsDepositorInsertPARP1 (PARP1 Human)
Tags3xFlagExpressionMammalianMutationlysine to glutamine mutation at the following ami…PromoterCMVAvailable SinceJuly 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP12-AAV-H1/TO-L-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82704PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP11-AAV-U6/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82705PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEP13-AAV-H1/TO-L-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82703PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTH733-2µ-RLuc/maxCFLuc
Plasmid#40608DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only