We narrowed to 10,235 results for: iCre
-
Plasmid#85879PurposeSensor PlasmidDepositorInsertmiR-512-3p Sensor
UseLentiviralPromoterPGKAvailable SinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCI-FLAG-mTUT4
Plasmid#60041PurposeMammalian expression of FLAG-tagged mouse TUT4DepositorAvailable SinceNov. 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
pG108-K - AhpC-Glow
Plasmid#185135PurposeBacteroides - Escherichia coli shuttle vector with TetQ and Kanamycin selection markers BS2 is cloned under the Bacteroides thetaiotaomicron ahpC promoterDepositorInsertsGlow gene
Bacteroides thetaiotaomicron ahpC promoter
UsePg106ExpressionBacterialAvailable SinceDec. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
AB.pCCL.sin.cPPT.GFP.miR-126-3p.sensor.PGK.dNGFR.WPRE
Plasmid#85908PurposeSensor PlasmidDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMT85_PS-mEos3.2_GentaR
Plasmid#173895PurposeTransposon allowing the expression of the fluorescent protein mEos3.2 in multiple mycoplasma species, under the control of the Spiralin promoterDepositorInsertmEos3.2
ExpressionBacterialPromoterSpiralinAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT85_P438-mEOS3.2_GentaR
Plasmid#173894PurposeTransposon allowing the expression of the fluorescent protein mEos3.2 in multiple mycoplasma species, under the control of the P438 promoterDepositorInsertmEos3.2
ExpressionBacterialPromoterP438Available SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
T2A 3xNLS GFP
Plasmid#227721PurposePlasmid contains T2A 3xNLS GFP, with some nlp-51 homology sequence before, Amp ResistantDepositorInsertT2A 3xNLS GFP with some nlp-51 homology sequence (nlp-51 Nematode)
UseCloning vectorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-mTUT2
Plasmid#60039PurposeMammalian expression of FLAG-tagged mouse TUT2DepositorAvailable SinceNov. 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
T2A GFP H2B
Plasmid#227722PurposePlasmid contains T2A GFP H2B, with some nlp-51 homology sequence before, Amp ResistantDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
AB.pCCL.sin.cPPT.GFP.miR-218-2-3p.sensor.PGK.dNGFR.WPRE
Plasmid#85881PurposeSensor PlasmidDepositorAvailable SinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMS158
Plasmid#215679PurposeEmpty repair plasmid for ChrIII split hygromycinR landing padDepositorInsert5'HA + MCS + lox2272 + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL2399
Plasmid#137051PurposeExpression of rapamycin-inducible dimerisation of split Cre from ribosomal locus in Leishmania parasite; pRIB-DiCreDepositorInsertsSplit Cre Recombinase Rapamycin Inducible Dimerisation
Blasticidin-S Deaminase
UseCre/Lox; Leishmania ribosomal locus expressionPromoterFor integration into the 18S ribosomal locusAvailable SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJB042 (FtsZ-mEos2)
Plasmid#49764PurposeInducible expression of FtsZ-mEos2 in bacteriaDepositorInsertFtsZ-mEos2
TagsmEos2ExpressionBacterialPromoterT5-lacAvailable SinceMarch 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
Sender_plasmid2
Plasmid#140693PurposeEncodes inducible expression of RhlI (C4-HSL quorum sensing synthase)DepositorInsertRhlI (rhlI )
TagsssrA degradation tag (ASV)ExpressionBacterialPromoterengineered lac promoter (IPTG inducible)Available SinceMay 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-mTUT3
Plasmid#60040PurposeMammalian expression of FLAG-tagged mouse TUT3DepositorAvailable SinceDec. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMS178
Plasmid#215678PurposeEmpty repair plasmid for ChrII split hygromycinR landing padDepositorInsert5'HA + MCS + loxP + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMay 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
AB.pCCL.sin.cPPT.U6.miR-335-5p-Decoy.hPGK.GFP.WPRE
Plasmid#46612DepositorInsertmiR-335-5p Decoy
UseLentiviralPromoterhU6Available SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only