We narrowed to 19,086 results for: REV;
-
Plasmid#233937PurposeMammalian expression of Chimeric Higher-Order Assemblies for Receptor Mediated Signaling (CHARMS) variant: CHARMS-20xTA with alanine mutation in the TRAF6 binding motifDepositorInsertCHARMS-20xTA-20xA
UseLentiviralTagsmEGFPExpressionMammalianPromoterSV40Available SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHRSV_CHARMS-TIR-5xT6BMs
Plasmid#233938PurposeMammalian expression of Chimeric Higher-Order Assemblies for Receptor Mediated Signaling (CHARMS) variant: CHARMS-TIR with 5 TRAF6 binding motifsDepositorInsertCHARMS-TIR-5xT6BMs
UseLentiviralTagsmEGFPExpressionMammalianPromoterSV40Available SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_Z11 gpN:SpyTag
Plasmid#225196PurposeUsed for adding C-terminal SpyTag to the Plesiomonas ZOR0011 P2 phage major capsid proteinDepositorInsertgpN homology arms and SpyTag
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS∆tum
Plasmid#225198PurposeUsed to create a markerless deletion of the E. coli HS tum geneDepositorInserttum homology arms
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS_lexA(Ind-)
Plasmid#225199PurposeUsed to create a non-inducible lexA by introducing a G85D mutation in E. coli HSDepositorInsertlexA homology arms
ExpressionBacterialMutationlexA G85DAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS_gpN:SpyTag
Plasmid#225193PurposeUsed for adding C-terminal SpyTag to the E. coli HS P2 phage major capsid proteinDepositorInsertgpN homology arms and SpyTag
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
ER-frNFAST
Plasmid#233599PurposeExpression of frNFAST on the ER membraneDepositorInsertfrNFAST
ExpressionMammalianPromoterCMVAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PM-frNFAST
Plasmid#233602PurposeExpression of frNFAST on the PM facing the cytosolDepositorInsertfrNFAST
ExpressionMammalianPromoterCMVAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCARGO-RMCE-Airn
Plasmid#233266PurposeCARGO plasmid containing ~90kb dox-inducible Airn transgeneDepositorInsertAirn (Airn Mouse)
ExpressionMammalianAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-FRB-Fis1 (no mt-mKeima)
Plasmid#223795PurposeStable expression of protein in mammalian cell cultureDepositorInsertFRB-Fis1
UseLentiviralTagsFRBAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-SCP1-TagBFP2-W3SL-BC(p1-10)
Plasmid#231355PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses TagBFP from SCP1 promoter.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-CAG-EGFP-W3SL-BC(p1-10)
Plasmid#231347PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from CAG promoter.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pscAAV.BC(p1-6)-CAG-EGFP-SV40pA-BC(p1-6)
Plasmid#231349PurposeSelf complementary AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from CAG promoter.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEW66
Plasmid#232794PurposeCOMPASS Fragment 1 (Cps60, Cps50, Cps35, Cps25, Cps15) in PBIG1aDepositorInsertTagsNo tagsExpressionInsectPromoterpolyhedrin promoterAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoRHA
Plasmid#232994PurposeGalactose iduced expression of Gcn4 SATtoG KtoRHAin yeastDepositorInsertGcn4 SATtoG KtoR
Tags3xHA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoR
Plasmid#232961PurposeGalactose iduced expression of Gcn4 ATtoG KtoR in yeastDepositorInsertGcn4 SATtoG KtoR
TagsTEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoRGFP
Plasmid#233006PurposeGalactose iduced expression of Gcn4 SATtoG KtoRGFP in yeastDepositorInsertGcn4 SATtoG KtoR
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 solvvol W
Plasmid#232977PurposeGalactose iduced expression of Gcn4 solvvol W+ in yeastDepositorInsertGcn4 solvvol W+
Tags3xHA and TEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 SATtoG KtoR
Plasmid#231861PurposeBacterial expression of N-terminally 6His tagged Gcn4 SATtoG KtoRDepositorInsertGcn4 SATtoG KtoR
Tags6xHis, TEV cleavage siteExpressionBacterialMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterT7Available SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only