We narrowed to 46,020 results for: cha

#98660

Expresses 6xHis-tagged hnRNPA2 AA 190-341 with D230V

Nicolas Fawzi

Ryan et al Mol Cell. 2018 Jan 17. pii: S1097-2765(1

Jan. 18, 2018

Academic Institutions and Nonprofits only

#104465

express His tagged P298L hnRNPA2 LC

Nicolas Fawzi

Ryan et al Mol Cell. 2018 Jan 17. pii: S1097-2765(1

Jan. 18, 2018

Academic Institutions and Nonprofits only

#104466

express MBP hnRNPA2 LC with 2 R to K mutations

Nicolas Fawzi

Ryan et al Mol Cell. 2018 Jan 17. pii: S1097-2765(1

Jan. 18, 2018

Academic Institutions and Nonprofits only

#104470

express His tagged P298L S329C hnRNPA2 LC

Nicolas Fawzi

Ryan et al Mol Cell. 2018 Jan 17. pii: S1097-2765(1

Jan. 18, 2018

Academic Institutions and Nonprofits only

#87390

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87388

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87389

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87393

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87398

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87400

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only