We narrowed to 44,084 results for: cha
-
Plasmid#104060PurposeAlso known as hSyn1-tdTomato-f. AAV expression of Farnylsated tdtomato for tracingDepositorInserttdTomato
UseAAVTagsExpressionMutationPromoterhSynAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-2xNLS-mTurquoise2
Plasmid#104053PurposeAn AAV genome encoding expression of the nuclear localized fluorescent protein mTurquoise2 from the GFAP promoterDepositorInsert2xNLS-mTurquoise2
UseAAVTagsNLSExpressionMutationPromoterGFAPAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVTagsExpressionMutationPromoterTREAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+)-HisTim12_CtoA
Plasmid#170281PurposeExpresses yeast Tim12 (the latter with cleavable N-ter His-tag), codon-optimized for E. coli productionDepositorInsertyeast Tim12 (TIM12 Budding Yeast)
UseTagsTEV-cleavable N-terminal His tag (on backbone)ExpressionBacterialMutationmutated two non-conserved Cys to AlaPromoterAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+_hsTRPA1_myc_dTom
Plasmid#183179Purposemyc tagged hsTRPA1 used for cell transfectionDepositorAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP
Plasmid#104055PurposeAn AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV2, and AAV5InsertEYFP
UseAAVTagsExpressionMutationPromoterCAGAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pECNUS4
Plasmid#184887PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-EYFP
Plasmid#104052PurposeAn AAV genome encoding Cre-dependent expression of the fluorescent protein EYFP from the CAG promoterDepositorHas ServiceAAV PHP.V1InsertEYFP
UseAAVTagsExpressionMutationPromoterCAGAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-eYFP
Plasmid#117382PurposeAn AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertEYFP
UseAAVTagsExpressionMammalianMutationPromoterhSyn1Available SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Lats1 (Nigg HS189)
Plasmid#41156DepositorInsertLats1 (LATS1 Human)
UseTags3xMyc and PreScission SiteExpressionMammalianMutationPromoterCMVAvailable SinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP
Plasmid#117383PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFPDepositorHas ServiceAAV1InsertEYFP
UseAAVTagsExpressionMammalianMutationPromoterTREAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1 TIM8,13
Plasmid#170282PurposeExpresses both yeast Tim8 and yeast Tim13 (the latter with cleavable N-ter His-tag), codon-optimized for E. coli productionDepositorInsertyeast Tim8 and Tim13 (TIM8 Budding Yeast)
UseTagsTEV-cleavable N-terminal His tag on Tim13 (on bac…ExpressionBacterialMutationPromoterAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pECNUS4_MP
Plasmid#228358PurposeABE8e-SpCas9-NG Multiplex Acceptor clone for insertion of up to six gRNA cassettes via Golden Gate with BpiI and T4 ligase, blue-white screeningDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS2
Plasmid#184885PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS3
Plasmid#184886PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS1
Plasmid#184884PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_OHu19986C_myc tag
Plasmid#183174Purposeused to make AAV vectors for hsTRPA1 tagged with mycDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSP64-mHCN2
Plasmid#53060PurposeExpresses alpha subunit of mouse HCN2 channel in Xenopus oocytesDepositorInsertPotassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 2 (Hcn2 Mouse)
UseXenopus oocyte expressionTagsExpressionMutationE55G, R237H, and K283R polymorphisms compared to …PromoterSP6Available SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only