We narrowed to 1,549 results for: Green Fluorescent Protein
-
Plasmid#82500PurposeExpresses GFP with 1 UAG codon at the amino acid position 3DepositorInsertGreen Fluorescent Protein with 1 UAG codon
ExpressionBacterialMutationAdded an UAG codon at the amino acid position 3PromoterAraBADAvailable SinceSept. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEM-GFP-URA3-GFP
Plasmid#72606PurposeTemplate for creating a C-terminal GFP tag AND an internal GFP tag from a single transfection of yeastDepositorInsertsGFP (full)
URA3
GFP (partial)
Optional Linker
MutationIncludes full 819 bp coding sequence of URA3, 435…Available SinceJan. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MfnG-EcYRS-EGFP*
Plasmid#191119PurposeA plasmid for incorporation of O-Me-Tyr into an EGFP reporter without O-Me-Tyr feeding for zebrafishDepositorInsertMfnG - P2A - Mutant E. coli TyrRS - T2A - enhanced green fluorescence protein
TagsHis tagExpressionMammalianAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pF CAG luc-EGFP-cre puro
Plasmid#67503PurposeConstitutive expression of a firefly luciferase-enhanced green fluorescent protein-cre recombinase fusion protein in mammalian cellsDepositorInsertluciferase-EGFP-cre
UseCre/Lox, Lentiviral, and Luciferase ; Fluorescent…ExpressionMammalianPromoterCAGAvailable SinceFeb. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
p1.2-GS-eGFP
Plasmid#162771PurposeFluorescent reporter for CHO expression studiesDepositorInsertenhanced green fluorescent protein
ExpressionMammalianMutationconsensus Kozak sequence (GCCGCCATGG) added befor…PromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)IRES GFP
Plasmid#51406PurposeExpresses GFP from internal ribosome entry sequence, cloning componentDepositorInsertIRES GFP
ExpressionMammalianPromoterCMVAvailable SinceMay 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJEP223-AAV-EFS-GFP-pA
Plasmid#62913PurposeAAV vector backbone designed to express GFP from a EFS promoter. It also contains a poly-Adenylation Signal (pA)DepositorInsertGreen Fluorescent protein (GFP)
UseAAVPromotershort form of Elongation Factor1α (EFS)Available SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP221-AAV-RSV-GFP-pA
Plasmid#62919PurposeAAV vector backbone designed to express GFP from a RSV promoter. It also contains a poly-Adenylation Signal (pA)DepositorInsertGreen Fluorescent protein (GFP)
UseAAVPromoterRous Sarcoma Virus(RSV)Available SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pReporter_5
Plasmid#60566PurposeA reporter plasmid containing the attB and attP sites flanking a green fluorescent protein reporter gene (gfp).DepositorInsertReporter_5
ExpressionBacterialPromoterBBa_J23119Available SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pReporter_7
Plasmid#60567PurposeA reporter plasmid containing the attB and attP sites flanking a green fluorescent protein reporter gene (gfp).DepositorInsertReporter_7
ExpressionBacterialPromoterBBa_J23119Available SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pmEGFP-N1
Plasmid#217486PurposeExpression of monomeric Enhanced Green Fluorescent ProteinDepositorInsertmEGFP
ExpressionMammalianPromoterCMVAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETM6-Amp-T7-roGFP
Plasmid#202464PurposeExpresses redox sensitive GFP (roGFP) with T7 inductionDepositorInsertreduction-oxidation sensitive green fluorescent protein
Tags6X-HisExpressionBacterialPromoterT7Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDOC-K-glmS-GFPrev
Plasmid#158060PurposeDonor plasmid for insertion of eGFP and the constitutive acpP promoter into the S. Typhimurium chromosome. GFP is in the reverse orientation relative to the kanamycin resistance selectable markerDepositorInsertGreen Fluorescent Protein optimised for excitation with UV light
UseSynthetic BiologyExpressionBacterialPromoteracpPAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-EGFP
Plasmid#114213PurposeAAV vector (control) that targets expression of EGFP to neuronsDepositorInsertEnhanced Green Fluorescent Protein
UseAAV and Mouse TargetingTagsNoneExpressionMammalianMutationNonePromoterhuman synapsin (hSyn)Available SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG/GFP
Plasmid#139980Purposeexpresses GFP under the promoter of CAG. Transgene flanked by AAV2 ITRDepositorInsertGreen fluorescent protein
UseAAVPromoterCAGAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-CMV-GFP-W
Plasmid#196046Purposelentiviral expression of the green fluorescent protein driven by cytomegalovirus virus promoterDepositorTypeEmpty backboneUseLentiviralTagseGFPPromoterCMVAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pReporter_8
Plasmid#60568PurposeA reporter plasmid containing the attB and attP sites flanking a green fluorescent protein reporter gene (gfp).DepositorInsertReporter_8
ExpressionBacterialPromoterBBa_J23119Available SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRII-TOPO CMV-cGFP-mMALAT1_3' WT Sense
Plasmid#46834PurposeExpress cGFP transcript ending in the wildtype MALAT1 triple helixDepositorInsertCoral Green Fluorescent Protein (cGFP)
ExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pReporter_3
Plasmid#60564PurposeA reporter plasmid containing the attB and attP sites flanking a green fluorescent protein reporter gene (gfp).DepositorInsertReporter_3
ExpressionBacterialPromoterBBa_J23119Available SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only