We narrowed to 83,057 results for: Mycs
-
Plasmid#113874Purposeexpression of Cas9 programming sgRNA2 and sgRNA1 targetting GAL2 and HXT4-1-5/ HXT3-6-7 respectivelyDepositorInsertsgRNA2 GAL2 sgRNA1-HXT4-1-5;HXT3-6-7
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBullet-end-n
Plasmid#53073Purposedestination vector with ECFP- endosome marker (RabF2a) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-pm-n
Plasmid#53077Purposedestination vector with PIP2a-ECFP (plasma membrane marker) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-vac-n
Plasmid#53075Purposedestination vector with vacuole marker (gamma-TIP) - ECFP for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
PB-EF1-H4-HaloTag-IRES-Neo
Plasmid#247450PurposeExpresses wild-type H4-Halo under EF1 promoter and can be randomly integrated by PiggyBac transposaseDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW11K_0S5
Plasmid#177282Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with SmRDepositorInsertPaadA-aadA
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-CNOT7-V5H6.MCh.Puro
Plasmid#209946PurposeIn mammalian cells expresses TP fused to a CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-CNOT6-V5H6.MCh.Puro
Plasmid#209944PurposeIn mammalian cells expresses TP fused to a CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 6 (CNOT6 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only