We narrowed to 22,520 results for: TES
-
Plasmid#192057PurposeExpression vector for SOX (ORF37) Q129HDepositorInsertSOX (ORF37) Q129H
ExpressionInsectMutationQ129HPromoterPolyhedrinAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmCherryC1-Pacer
Plasmid#216698PurposeMammalian expression of PacerDepositorAvailable SinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-NCYC110
Plasmid#226273PurposePlasmid expressing the SEC22 allele from NCYC110, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-L1374
Plasmid#226271PurposePlasmid expressing the SEC22 allele from L-1374, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-UWOPS872421
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-S288C
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM227
Plasmid#226650PurposeMSS-His6-UFD1LDepositorAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-NCYC110
Plasmid#226279PurposePlasmid expressing the SSD1 allele from NCYC110, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28_LmFPPS
Plasmid#186322PurposepET-28a vector (Novagen) (encoding an N-terminal His tag), to transform Escherichia coli BL21 (DE3) cellsDepositorInsertFPPS
TagsHis TagExpressionBacterialAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only