We narrowed to 9,235 results for: mel
-
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-ΔPLD
Plasmid#195479PurposepInducer21 plasmid containing the human MEFV gene with a deletion of residues 88 - 310 (the resulting pyrin protein lacks the Phosphorylated Linker Domain domain) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationdeletion of residues 88 - 310 (the resulting pyri…Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGGG_Sr1644-1Sh
Plasmid#164087PurposeExpresses pGGG_Sr1644-1Sh in plantsDepositorInsertpGGG_Sr-1644-1Sh
TagsnoneExpressionBacterial and PlantPromoterNative promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-gB-PuroR [M1G]
Plasmid#171803PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, HSV-1 glycoprotein B CD8+ T cell epitope [AA: 498-505 (SSIEFARL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-gB-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-Ova-BlastR [M1G]
Plasmid#171817PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, Ovalbumin CD8+ T cell epitope [AA: 257-264 (SIINFEKL)] and blasticidin resistance cassette [p.M1G]DepositorInsertmScarlet-F-Ova-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-gB-BlastR [M1G]
Plasmid#171816PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, HSV-1 glycoprotein B CD8+ T cell epitope [AA: 498-505 (SSIEFARL)] and blasticidin resistance cassette [p.DepositorInsertmScarlet-F-gB-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-hgp100-BlastR [M1G]
Plasmid#171815PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, human gp100 CD8+ T cell epitope [AA: 25-33 (KVPRNQDWL)] and blasticidin resistance cassette [p.M1G]DepositorInsertmScarlet-F-hgp100-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-gB-PuroR [M1G]
Plasmid#171812PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, HSV-1 glycoprotein B CD8+ T cell epitope [AA: 498-505 (SSIEFARL)] and puromycin resistance cassette [p.M1DepositorInsertmScarlet-F-gB-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only