We narrowed to 1,690 results for: Tyr
-
Plasmid#65444PurposeExpression of human EPHB4 and GFP in mammalian cellsDepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only
-
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKM-U6-reRNA-hsHEKsite_1_3
Plasmid#205638PurposereRNA guide targeting HEKsite_1_3DepositorAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK Puro GFP-GABARAPL1 G116
Plasmid#123243PurposeExpression vector with PGK promoter for low expression of EGFP-GABARAPL1 G116. For lentivirus production and stable transduction in mammalian cells.DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationDeleted amino acid 117. Stop codon after G116PromoterPGKAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T1-ISG15 C78SN13Y
Plasmid#165106Purposebacterial expressio of a GST fusion of Human ISG15 C78SN13YDepositorInsertISG15 (ISG15 Human)
TagsGST from plasmid.ExpressionBacterialMutationC78SN13Y; The sequence of ISG15-C78S/N13Y contai…Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
MERTK_HUMAN_D0
Plasmid#79705PurposeThis plasmid encodes the kinase domain of MERTK. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GFP-EphrinB3-Flag(A227Y)
Plasmid#155013PurposeExpresses N-terminally GFP-tagged and C-terminally Flag-tagged EphrinB3 A227Y variant from pcDNA3.1DepositorInsertEphrinB3 (EPHB3 Human)
TagsFlag, GFP, and signal peptide (residues 1 to 32) …ExpressionMammalianMutationA227YPromoterCMVAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
EPHB4-2A-EGFP
Plasmid#139968PurposeDonor vector to knockin EGFP (separated by 2A) into EPHB4 alleleDepositorInsertHuman EPHB4 knockin homology arms (EPHB4 Human)
ExpressionMammalianAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-OptoFGFR1-Y766F
Plasmid#59777PurposeExpresses optoFGFR1 with mutation in PLC-gamma binding phosphotyrosine site of FGFR1DepositorAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK Puro GFP-GABARAPL1 G116A
Plasmid#123245PurposeExpression vector with PGK promoter for low expression of EGFP-GABARAPL1 G116A. For lentivirus production and stable transduction in mammalian cells.DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationGlycine 116 to AlaninePromoterPGKAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
EPHB4 gRNA (BRDN0001145313)
Plasmid#76354Purpose3rd generation lentiviral gRNA plasmid targeting human EPHB4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
EPHB4 gRNA (BRDN0001144879)
Plasmid#76352Purpose3rd generation lentiviral gRNA plasmid targeting human EPHB4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHB4 gRNA (BRDN0001148436)
Plasmid#76353Purpose3rd generation lentiviral gRNA plasmid targeting human EPHB4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CmCitrine Lck w/ NosUTRs
Plasmid#66785Purposeexpression of fluorescent membranes in sea urchin primordial germ cellsDepositorInsertLck (LCK Human)
UseSea urchin, zebrafish, xenopusTags3' UTR from sea urchin Nanos, 5' UTR fr…MutationTandem repeat of LCK the N-terminal membrane targ…PromoterT7Available SinceJuly 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
EPHB3_HUMAN_D0
Plasmid#79732PurposeThis plasmid encodes the kinase domain of EPHB3. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHA3_HUMAN_D0
Plasmid#79708PurposeThis plasmid encodes the kinase domain of EPHA3. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHB2_HUMAN_D0
Plasmid#79697PurposeThis plasmid encodes the kinase domain of EPHB2. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-Af1521(K35E/Y145R)-myc
Plasmid#196237PurposeAf1521(K35E/Y145R) macrodomain with a myc tag fused to the C terminus & a hygromycin resistance cassetteDepositorInsertAf1521(K35E/Y145R) encoding a C-terminal myc tag
UseLentiviralTagsmyc tagExpressionMammalianMutationamino acid 35 lysine is replaced with glutamic ac…PromoterEF1AAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_SBP-EGFP-LAMP1-Y414A
Plasmid#222319PurposeSynchronize the trafficking of LAMP1-Y414A from the ER.DepositorInsertStreptavidin-KDEL and LAMP1-Y414A fused to SBP-EGFP (LAMP1 Human)
ExpressionMammalianMutationTyr414 to AlaPromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only