We narrowed to 2,609 results for: ERK
-
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28:LanIV-Chondromyces
Plasmid#225078PurposeExpresses precursor peptide and lanthipeptide synthetase from Chondromyces LanIV (FAST-RiPPs) in E. coliDepositorInsertLanA (LanIV-Chondromyces)
TagsHis6ExpressionBacterialMutationWTPromoterT7Available SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28:LanI-101
Plasmid#225065PurposeExpresses precursor peptide, lanthipeptide cyclase, and lanthipeptide dehydratase from LanI-101 (FAST-RiPPs) in E. coliDepositorInsertLanA (LanI-101)
TagsHis6ExpressionBacterialMutationWTPromoterT7Available SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWZL-hygro-FAKS722A
Plasmid#216545PurposeThis retroviral plasmid expresses a mutated cDNA (dominant negative: S722A) of human PTK2DepositorInsertPTK2 (S722A) (PTK2 Human)
UseRetroviralTagsNoExpressionMammalianMutationFAK dominant negative mutation S722AAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWZL-hygro-FAKY861F
Plasmid#216546PurposeThis retroviral plasmid expresses a mutated cDNA (dominant negative: Y861F) of human PTK2DepositorInsertPTK2 (Y861F) (PTK2 Human)
UseRetroviralTagsNoExpressionMammalianMutationFAK dominant negative mutation Y861FAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWZL-hygro-FAKS732A
Plasmid#216541PurposeThis retroviral plasmid expresses a mutated cDNA (dominant negative: S732A) of human PTK2DepositorInsertPTK2 (S732A) (PTK2 Human)
UseRetroviralTagsNoExpressionMammalianMutationFAK dominant negative mutation S732AAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only