We narrowed to 13,094 results for: BASE

#121842

pMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; empty hU6-driven xCas9(3.7) gRNA scaffold for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA fusion to dCas9 w/ gRNA expression

Christopher Newgard

Haldeman et al Nucleic Acids Res. 2018 Dec 27. pii: 526

June 27, 2019

Academic Institutions and Nonprofits only

#97322

HMEJ donor for fusing a p2A-mCherry reporter to mouse Sox2. AAV backbone.

Hui Yang

Yao et al Cell Res. 2017 May 19. doi: 10.1038/cr.2

July 14, 2017

Academic Institutions and Nonprofits only

#114088

U6 promoter crRNA entry vector used for all MbCas12a crRNAs (clone spacer oligos into BsmBI cassette)

Keith Joung, Benjamin Kleinstiver

Kleinstiver et al Nat Biotechnol. 2019 Feb 11. pii: 10.103

Dec. 10, 2018

Academic Institutions and Nonprofits only

#199263

Single AAV vector for expressing N-terminal fusion Nme2Cas9-ABE8e and one U6 driven sgRNA targeting the point mutation in the mouse Fah gene of a HT1 mouse model

Erik Sontheimer

Zhang et al GEN Biotechnol. 2022 Jun 1;1(3):285-299.

April 10, 2023

Academic Institutions and Nonprofits only

#114090

CAG promoter expression plasmid for human codon optimized MbCas12a nuclease with C-terminal NLS and HA tag

Keith Joung, Benjamin Kleinstiver

Kleinstiver et al Nat Biotechnol. 2019 Feb 11. pii: 10.103

Dec. 10, 2018

Academic Institutions and Nonprofits only

#110851

Lentiviral vector for constitutive expression of Cas9-VQRRA in mammalian cells (codon optimized)

Lukas Dow

Zafra et al Nat Biotechnol. 2018 Jul 3. pii: nbt.419

June 27, 2018

Academic Institutions and Nonprofits only

#104611

Expresses TALE3 under the control of a 2.4kb mhc enhancer element

Tudor Fulga

Toegel et al Nat Commun. 2017 Nov 21;8(1):1663. doi:

Jan. 29, 2018

Academic Institutions and Nonprofits only

#170345

6xHis_mT2Del_EPACdDEPCD_Q270E_cp174Cit biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.

Kees Jalink

Klarenbeek et al PLoS One. 2015 Apr 14;10(4):e0122513. do

Oct. 27, 2021

Academic Institutions and Nonprofits only

#111088

pET-pro-siRNA-V2 based plasmid for production of recombinant siRNAs (pro-siRNAs) against human Lamin A/C gene.

Linfeng HUANG

Kaur et al Biotechnol Bioeng. 2018 Jun 5. doi: 10.1

March 1, 2019

Academic Institutions and Nonprofits only

#87409

p426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only