We narrowed to 7,703 results for: lentivirus vector
-
Plasmid#216093PurposeCas9 [Sp] CRISPRi targeting CD55, positive controlDepositorInsertCD55 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDB_131
Plasmid#216095PurposeCas12a [EnAs] CRISPRa targeting CD97, CD4, CD26, CD274, positive controlDepositorInsertCD97, CD4, CD26, CD274 guides
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA_816
Plasmid#216098PurposeCRISPRa, EF1a-driven ALFA-dCas12a-VP64 (Cas only)DepositorInsertCas12a [EnAs]
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX304_miRFP670nano-P2A-ERM-gCam6f
Plasmid#214927PurposeExpress miRFP670nano P2A ERM-gCaMP6f (fluorescent proteins and genetic calcium sensor, gCaMP6f for normalizing factor and sensing calcium ions at cytosol exposed to ERM, respectively)DepositorInsertmiRFP670nano-P2A-ERM-gCam6f
UseLentiviralExpressionMammalianPromoterCMVpAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-ZFYVE27 S14D S25D S32D T261D-WPRE-UbC-mCherry
Plasmid#214471PurposeLentiviral vector plasmid expressing human ZFYVE27 mutations S14D S25D S32D T261D under the spleen focus-forming virus (SFFV) promoter and mCherry under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralExpressionMammalianMutationS14D S25D S32D T261DAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT4_short_mCherry2-NLS-PEST_Puro
Plasmid#213774PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT4_short_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT4_mCherry2-NLS-PEST_Puro
Plasmid#213773PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT4_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT3_short_mCherry2-NLS-PEST_Puro
Plasmid#213772PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT3_short_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT2_mCherry2-NLS-PEST_Puro
Plasmid#213769PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT2_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT2_short_mCherry2-NLS-PEST_Puro
Plasmid#213770PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT2_short_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT1_mCherry2-NLS-PEST_Puro
Plasmid#213767PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT1_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT1_short_mCherry2-NLS-PEST_Puro
Plasmid#213768PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT1_short_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti4/V5-DEST-AERRIE
Plasmid#204023PurposeLentiviral vector expressing human long non-coding RNA AERRIE (linc01013)DepositorAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-Llgl1-WPRE-UbC-Emerald
Plasmid#203805PurposeLentiviral vector plasmid expressing mouse Llgl1 under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJuly 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_SFFV*/Puro2a-PAG1-GFP
Plasmid#198223PurposeLentiviral plasmid derived from pHR_SFFV (Addgene #79121) expressing cDNA for a codon-optimized puromycin resistance gene, followed by an FMDV 2A domain and then EGFPDepositorInsertPAG1 (PAG1 Human)
UseLentiviralTagsFollowed by EGFP, after a flexible linker and Pre…ExpressionMammalianMutationNoneAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti4/V5-DEST-LASSIE
Plasmid#192105PurposeLentiviral vector expressing long non-coding RNA LASSIE (linc00520)DepositorInsertLASSIE
UseLentiviralPromoterCMVAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP229-Lenti-TRE3G-4xMyc-GluN2B-WPRE-pA
Plasmid#164794PurposepLenti vector backbone designed to express 4XMyc Tagged-GluN2B from a TRE3G promoter.DepositorInsertGluN2B
UseLentiviralTags4xMycAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only