We narrowed to 2,707 results for: EXO
-
Plasmid#206178PurposeExpresses Cre recombinase specifically in cardiomyocytes and uses U6 promoter to express sgRNAs targeting murine Lmna exon 10DepositorInsertCre
UseAAVPromotercTnTAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
cacna2d1 R241A pMT2
Plasmid#206110Purposeexpression of rat alpha2delta-1 calcium channel auxillary subunit and with R421A mutation that disrupts Gabapentin bindingDepositorAvailable SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-π-EB1_IRES-mCherry
Plasmid#197427PurposeHomology-directed repair template targeting IRES-based π-element to MAPRE1 exon 5DepositorInsertIRES-based π-element with HDR templates flanking MAPRE1 exon 5 insertion site (MAPRE1 Human)
UseCRISPR and Synthetic BiologyTagsGCN4 leucine zipper, LOV2, Zdk1, and mCherryAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-π-EB1_EF1α-mCherry
Plasmid#197429PurposeHomology-directed repair template targeting EF1α-based π-element to MAPRE1 exon 5DepositorInsertEF1α-based π-element with HDR templates flanking MAPRE1 exon 5 insertion site (MAPRE1 Human)
UseCRISPR and Synthetic BiologyTagsGCN4 leucine zipper, LOV2, Zdk1, and mCherryAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-π-EB1_EF1α-EGFP
Plasmid#197430PurposeHomology-directed repair template targeting EF1α-based π-element to MAPRE1 exon 5DepositorInsertEF1α-based π-element with HDR templates flanking MAPRE1 exon 5 insertion site (MAPRE1 Human)
UseCRISPR and Synthetic BiologyTagsEGFP, GCN4 leucine zipper, LOV2, and Zdk1Available SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
hTln1-R1R2
Plasmid#191440PurposeExpresses the human TLN1 R1R2 domains in bacteriaDepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmPAN2-del1047-1063-GSG-dsRNAres_Y
Plasmid#148070PurposeInsect Expression of DmPAN2-del1047-1063-GSG-dsRNAresDepositorInsertDmPAN2-del1047-1063-GSG-dsRNAres (PAN2 Fly)
ExpressionInsectMutationone silent mutation compared the the sequence gei…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsDCP1a-Y36A_P
Plasmid#147218PurposeMammalian Expression of HsDCP1a-Y36ADepositorInsertHsDCP1a-Y36A (DCP1A Human)
ExpressionMammalianMutationtwo silent mutations T237C and G1716T compared to…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsDCP1a-Y36A_P
Plasmid#147221PurposeMammalian Expression of HsDCP1a-Y36ADepositorInsertHsDCP1a-Y36A (DCP1A Human)
ExpressionMammalianMutationtwo silent mutations T237C and T1716G compared to…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-HsSmg6-del136-152-siRNAres_K
Plasmid#146750PurposeMammalian Expression of HsSmg6-del136-152-siRNAresDepositorInsertHsSmg6-del136-152-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETM41P-HsUPF3b-iso2_145-470_K
Plasmid#146754PurposeBacterial Expression of HsUPF3biso2_145-470DepositorInsertHsUPF3biso2_145-470 (UPF3B Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1-HsUPF3b-iso2_145-470_K
Plasmid#146759PurposeBacterial Expression of HsUPF3biso2_145-470DepositorInsertHsUPF3biso2_145-470 (UPF3B Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-HsSmg6-del42-58-del136-152-siRNAres_K
Plasmid#146748PurposeMammalian Expression of HsSmg6-del42-58-del136-152-siRNAresDepositorInsertHsSmg6-del42-58-del136-152-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-HsSmg6-del817-1238-siRNAres_I
Plasmid#146555PurposeMammalian Expression of HsSmg6-del817-1238-siRNAresDepositorInsertHsSmg6-del817-1238-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-HsSmg6-del817-1238-siRNAres_I
Plasmid#146564PurposeMammalian Expression of HsSmg6-del817-1238-siRNAresDepositorInsertHsSmg6-del817-1238-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLNHA-C1-HsUPF3biso2_I
Plasmid#146568PurposeMammalian Expression of HsUPF3Biso2DepositorInsertHsUPF3Biso2 (UPF3B Human)
ExpressionMammalianMutationone silent mutation T510C compared to the sequenc…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Tau Authentic Alu 10-12WT
Plasmid#194167PurposeInsert contains intronic Tau authentic Alu and repeat elements. The introns are flanked by the Wild Type tau cDNA exons 10-12 . Expresses the tau circular RNA 12-->10 WT with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 WT
Tags3X FlagExpressionMammalianAvailable SinceJan. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Tau Authentic Alu 7-12WT
Plasmid#194170PurposeInsert contains intronic Tau authentic Alu and repeat elements. The introns are flanked by the Wild Type tau cDNA exons 7,9-12 . Expresses the tau circular RNA 12-->7 WT with 3X flag tag in exon 7.DepositorInsertmicrotubule-associated protein tau 7-12 WT
Tags3x FlagExpressionMammalianAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12V337M
Plasmid#194165PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by tau cDNA exons 10-12 with FTLD-Tau V337M mutation. Expresses the tau circRNA 12-->10 V337M with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 V337M
ExpressionMammalianMutationChanged Valine 337 to MethinonineAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only