We narrowed to 17,175 results for: IGH@;
-
Plasmid#226273PurposePlasmid expressing the SEC22 allele from NCYC110, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-L1374
Plasmid#226271PurposePlasmid expressing the SEC22 allele from L-1374, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-UWOPS872421
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-S288C
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-NCYC110
Plasmid#226279PurposePlasmid expressing the SSD1 allele from NCYC110, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBWB507
Plasmid#209325Purposep15A-tetR-tet-ME-RBS-mRFP-ME-U1-Barcode-U2-dbI terminator-oriT-Cm. Plasmid backbone for fragment expression.DepositorInsertmRFP
ExpressionBacterialPromotertetAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDLterm
Plasmid#211903PurposeBase plasmid for dual-luciferase constructs to measure terminator strengthDepositorTypeEmpty backboneUseLuciferaseExpressionPlantPromoter35S enhancer + 35S minimal promoterAvailable SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-IvfChr-citrine
Plasmid#221614PurposeA recombinant AAV2 plasmid encoding vfChrimson-citrine with trafficking enhancement.DepositorInsertvfChrimson-citrine with membrane trafficking enhancement
UseAAVMutationvfChrimson with membrane trafficking enhancementPromoterHuman SynapsinAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipT-mScarlet-KV2.1
Plasmid#221617PurposeA recombinant AAV2 plasmid encoding the ZipACR I151V mutant and soma targeting with KV2.1 motif.DepositorInsertZipACR (I151T)-mScarlet with soma targeting
UseAAVMutationZipACR (I151T) with soma targetingPromoterHuman SynapsinAvailable SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only