We narrowed to 5,965 results for: crispr cas9 expression plasmids
-
Plasmid#184918PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_nat recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_mic
Plasmid#184920PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_mic recombines in vivo with a PCR product from pEasyG3_zeo/nat/hph.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_hph
Plasmid#184919PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_hph recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_zeo
Plasmid#184913PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_zeo recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_nat
Plasmid#184914PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_nat recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_hph
Plasmid#184915PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_hph recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_mic
Plasmid#184916PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_mic recombines in vivo with a PCR product from pEasyG2_zeo/nat/hph.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_zeo
Plasmid#184917PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_zeo recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEP-GluA1 TKIT
Plasmid#169441PurposeExpression of 2 guides + donor DNADepositorInsertSuper ecliptic pHluorin (SEP)
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEP-GluA2 TKIT
Plasmid#169442PurposeExpression of 2 guides + donor DNADepositorInsertSuper ecliptic pHluorin (SEP)
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX856
Plasmid#62888PurposeC-term SpCas9 piece of inducible transcriptional activator (dCas9(C)-FKBP-2xNLS-VP64)DepositorInsertSpCas9 (aa536-1368)
UseCRISPRTagsFKBP12, NLS, NLS SV40, and VP64ExpressionMammalianMutationAsparagine 863 to Alanine (N863A)PromoterCBhAvailable sinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX855
Plasmid#62887PurposeN-term SpCas9 piece of inducible transcriptional activator (dCas9(N)-FRB-2xNES)DepositorInsertSpCas9 (aa 2-535)
UseCRISPRTagsFRB and NES PTK2ExpressionMammalianMutationAspartic acide 10 to Alanine (D10A)PromoterCBhAvailable sinceMarch 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDB4282
Plasmid#98701PurposeA plasmid containing the 3' portion of the ura4 marker and the gRNA elements downstream of the target sequence. It serves as the PCR template for generating the gRNA insert in the split-ura4 systemDepositorInsertgRNA PCR template
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDB4283
Plasmid#98702PurposeA plasmid containing the 3' portion of the bsdMX marker and the gRNA elements downstream of the target sequence. It serves as the PCR template for generating the gRNA insert in the split-bsdMX systemDepositorInsertgRNA PCR template
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMLS234
Plasmid#73682PurposeSapTrap 3-site Destination vector for N-terminal GFP tagging with embedded Cbr-unc-119 selectable markerDepositorInsertGFP + Cbr-unc-119
UseCRISPR and Cre/LoxTagsGFPExpressionWormMutationPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-MBP-NLS-Geo_st
Plasmid#87703PurposeExpression plasmid for Cas9 from Geobacillus stearothermophilus with an N-Term MBP and SV40 NLSDepositorInsertGeoCas9
UseTags10xHis-MBP-TEVExpressionBacterialMutationPromoterAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorInsertKAE1 gRNA (KAE1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorInsertSAM50 gRNA (SAM50 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorInsertARB1 gRNA (ARB1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorInsertRER2 gRNA (RER2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only