We narrowed to 18,057 results for: puro
-
Plasmid#247930PurposeOverexpression vector for eGFP tagged ESR1 or ERα. Monitor post-translational degradation of ERα via EGFP:mCherry ratio. Contains puromycin-resistance selection marker.DepositorAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLVX-EF1_-FCRL3-50aa-puro
Plasmid#248153PurposeLentiviral vector encoding a truncated form of human FCRL3, containing only the first 50 residues of the cytoplasmic tail.DepositorInsertFCRL3 (FCRL3 Human)
UseLentiviralMutationMutagenesis to insert a stop codon at aa645 in FC…PromoterEF1_Available SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1_-FCRL3-16aa-puro
Plasmid#248152PurposeLentiviral vector encoding a truncated form of human FCRL3, containing only the first 16 residues of the cytoplasmic tail.DepositorInsertFCRL3 (FCRL3 Human)
UseLentiviralMutationMutagenesis to insert a stop codon at aa611 in FC…PromoterEF1_Available SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1_-FCRL3-3xFLAG-puro
Plasmid#248155PurposeLentiviral vector expressing human FCRL3 with 3xFLAG tagsDepositorInsertFCRL3 (FCRL3 Human)
UseLentiviralTags3x FLAGMutationA 3xFLAG epitope tag is fused in frame to the C-t…PromoterEF1_Available SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1_-FCRL3-93aa-puro
Plasmid#248154PurposeLentiviral vector encoding a truncated form of human FCRL3, containing only the first 93 residues of the cytoplasmic tail.DepositorInsertFCRL3 (FCRL3 Human)
UseLentiviralMutationMutagenesis to insert a stop codon at aa688 in FC…PromoterEF1_Available SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1_-FCRL3-IRES-puro
Plasmid#248148PurposeLentiviral vector encoding human FCRL3DepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_G198R
Plasmid#242465PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The G198R mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationG198RPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_L199R
Plasmid#242466PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The L199R mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationL199RPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_L199G
Plasmid#242467PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The L199G mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationL199GPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_ANK3-4
Plasmid#242468PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The ANK3-4 mutations disrupt XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationANK3-4 = R87A - E95A - K96A - W124G - K128GPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-Tag100-hASB8
Plasmid#242460PurposeExpresses human ASB8 protein with an N-terminal Tag100 along with a puromycin selection marker.DepositorAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-Tag100-hASB8_G198R
Plasmid#242461PurposeExpresses human ASB8 protein with an N-terminal Tag100 along with a puromycin selection marker. The G198R mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTagsTag100ExpressionMammalianMutationG198RPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8
Plasmid#242464PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker.DepositorAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-rtTA-BG-CMV-PuroR-BGH_pKG1701
Plasmid#246376PurposeExpression plasmid for rtTA and PuroRDepositorInsertrtTA
UseSynthetic BiologyExpressionMammalianMutationnoneAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
ER-GFP Q185N N186C pLVX CMVpuro
Plasmid#246913PurposeLentiviral-based expression of EGFP with an ER retention signal sequence and Q185N N186C, an STT3B-specific glcosylation sequonDepositorInsertEGFP
UseLentiviralTagsER signal sequence and KDEL ER retention sequenceExpressionMammalianMutationQ185N N186C STT3B-specific sequon to allow for fl…PromoterCMVAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/Puro-CAG-JEDI-2Psub
Plasmid#247186PurposeGenetically encoded voltage indicator (GEVI) JEDI-2Psub expressed under strong mammalian promoter (CAG)DepositorInsertJEDI-2Psub
ExpressionMammalianPromoterCAGAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ35-EZ-Tet-pLKO-shNKX3.1-Puro
Plasmid#131078Purposeinducible NKX3-1 knock downDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ22-AAVS1-Puro-CAG-ASAP2f
Plasmid#131066PurposeDonor plasmid of targeted ASAP2f knockinDepositorInsertASAP2f
UseCRISPRExpressionMammalianAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ09-lenti-EF1a-NKX6.1-puro
Plasmid#131054PurposeForced expression of NKX6.1DepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNK036C_AttB_mkozak_mGreenLantern-STIM1_IRES_mCherry-H2A-P2A-PuroR
Plasmid#232938PurposeLow expression plasmid of STIM1 with N-terminal mGreenLantern tag for Matreyek Bxb1 (GT) landing padDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro-EF1A-hOGG1/Myc
Plasmid#187034PurposeA myc tag fused to the C-terminus of OGG1 and a puromycin resistance cassetteDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTWIST CMV Puro EPB41L4A ORF
Plasmid#242647PurposeExpresses EPB41L4A in mammalian cellsDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-epegRNA eBAR3-SV40-puro
Plasmid#240537PurposeLentiviral eBAR3 backbone plasmid to insert epegRNAs (tevopreq1) of interest with puromycin resistance. The cloning site is BsmBI.DepositorInsertepegRNA-eBAR3
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-epegRNA eBAR2-SV40-puro
Plasmid#240536PurposeLentiviral eBAR2 backbone plasmid to insert epegRNAs (tevopreq1) of interest with puromycin resistance. The cloning site is BsmBI.DepositorInsertepegRNA-eBAR2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-IRES-PURO-RAC1-R66A
Plasmid#241369PurposeLentiviral expression of mutant Rac1DepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-IRES-PURO-RAC1-Y64F
Plasmid#241370PurposeLentiviral expression of mutant Rac1DepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-E14-ABE-Cas9n-puro
Plasmid#226588PurposeExpress E14-ABE in mammalian cellsDepositorInsertE14-ABE
UseCRISPRExpressionMammalianAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-chGrb2/eDHFR(69K6)-iRFP713
Plasmid#214828PurposeEncoding Grb2-eDHFR(69K6) chimera fused to iRFP713DepositorInsertGrb2(1-59)-eDHFR(69K6)-Grb2(152-216)-iRFP713
TagsiRFP713ExpressionMammalianPromoterCAG promoterAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SV40-puro-EF1a-HA-NLGN1dAChE-bc
Plasmid#220437PurposeExpresses HA-tagged human NLGN1 with K578A/V579A substitutionsDepositorInsertNeuroligin-1 (NLGN1 Human)
UseLentiviralTagsHA-tagExpressionMammalianMutationK578A and V579A substitutionsPromoterEF1aAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only