We narrowed to 31,870 results for: ica
-
Plasmid#218117PurposeMET-HYGRO plasmid (218133) with the functional cassettes of pY2 (218115) inserted at the sfGFP dropout locus.DepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pY2-LYS-IV
Plasmid#218118PurposeLYS-Leu2 plasmid (218114) with the functional cassettes of pY2 (218115) inserted at the sfGFP dropout locus.DepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUPD3
Plasmid#118043PurposeGoldenBraid2.0 Universal Part Domesticator #3DepositorTypeEmpty backboneUseSynthetic Biology; Domestication of dna parts for…Available SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHK316
Plasmid#235474PurposeInducible gene VIII by Ptet promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK352.3
Plasmid#235473PurposeMessage phagemid carrying sgRNA3 (prom. J23110, backbone RSF1030)DepositorInsertsgRNA3
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETM6-T7-VHH72
Plasmid#202487PurposeExpresses the nanobody VHH72 with T7 inductionDepositorInsertnanobody VHH72
Tags6XHisExpressionBacterialPromoterT7Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDRFLIP38
Plasmid#65516PurposeFRET biosensor Destination vector for yeast expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-edCit-attR1 and attR2-edCer-cMycExpressionYeastPromoterpPMA1Available SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
human p53-(82-360)
Plasmid#24868DepositorAvailable SinceAug. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only