We narrowed to 13,106 results for: BASE
-
Plasmid#180357Purposemammalian co-expression of human SEPT2 NCmut fused to GFP10 and of human SEPT2 NCmut fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT2 F20D, V27DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pTRIP TRE BI_SEPT9_i1 NCmut-14-GFP11_SEPT9_i1 NCmut-14-GFP10
Plasmid#180358Purposemammalian co-expression of human SEPT9_i1 NCmut fused to GFP10 and of human SEPT9_i1 NCmut fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT9_i1 I281D, M288DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-pLenti-ACTA2-R179 (WT) (LLH661)
Plasmid#242682PurposePlasmid for expression of ACTA2-R179 (wild-type) cDNA from a lentiviral cassetteDepositorInsertpLenti-ACTA2-R179_cDNA
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB OROV Gc Spike H6
Plasmid#229662PurposeMake PiggyBac stable cell line expressing Oropouche virus BeAn 19991 Gc spike region (residues 482–894 of M polyprotein) with C-terminal His6 tagDepositorInsertOROV Gc spike
UsePiggybacTags6xHisExpressionMammalianMutationcontains residues 482-894 onlyPromoterTREAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_GFP11-14-SEPT7 Gmut1_GFP10-14-SEPT7 Gmut1
Plasmid#180354Purposemammalian co-expression of human SEPT7 Gmut1 fused to GFP10 and of human SEPT7 Gmut1 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT7 W269A, H279DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_GFP11-14-SEPT7 Gmut1_SEPT9_i1 Gmut-14-GFP10
Plasmid#180355Purposemammalian co-expression of human SEPT9_i1 Gmut fused to GFP10 and of human SEPT7 Gmut1 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT7 W269A, H279D and SEPT9_i1 W520A, H530DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_GFP11-14-SEPT7 Gmut1_SEPT9_i3 Gmut-14-GFP10
Plasmid#180356Purposemammalian co-expression of human SEPT9_i3 Gmut fused to GFP10 and of human SEPT7 Gmut1 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT7 W269A, H279D and SEPT9_i3 W502A, H512DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_SEPT9_i3 NCmut-14-GFP11_SEPT9_i3 NCmut-14-GFP10
Plasmid#180360Purposemammalian co-expression of human SEPT9_i3 NCmut fused to GFP10 and of human SEPT9_i3 NCmut fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT9_i3 I263D, M270DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-XRCC1-EGFP-T2A-Myc-POLB(K35A/K68A/K72/PAMmut)
Plasmid#176140PurposeEGFP fused to the C-terminus of XRCC1, linked by T2A to N-terminus Myc-tagged POLB with the mutations Lys35Ala, Lys68Ala, Lys72Ala, a mutation in the PAM site used by POLBKO gRNA1 & a hygromycin resisDepositorUseLentiviralTagsEGFP and MYCExpressionMammalianMutationMyc-tagged PolB with mutations Lys35 to Ala, Lys6…PromoterEF1AAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only