We narrowed to 81 results for: tet off
-
TypeBlog Post...2nd generation Tet-Off vectors (Tet-Advanced)” are the most recent variants of the Tet-Off system. For ...gene-function/tet-inducible-expression-systems/tet-systems-legacy-products/tet-on-and-tet-off-2nd-generation...10.1101/gad.2.6.718. PMID: 2843425.Takara Bio. Tet-On and Tet-Off systems: second generation. https://www.takarabio.com...promoters Tet-Off In its native context, the tetracycline repressor (TetR) can bind to the tetracycline operator...promoter and turning transcription OFF. Despite their bacterial origins, Tet systems function well in mammalian... post. In the past 30 years since the original Tet-Off system was described by Gossen and Bujard, both...operator sequences (TetO), preventing transcription. In the presence of tetracycline (Tet), TetR preferentially...
-
Plasmids 101: The protein expression toolbox
TypeBlog Post...come in two varieties: tet-on and tet-off. As the names imply, tet-off turns off constitutively expressed...options together. Turn it off Turn it off forever If you want to turn off protein expression, you are...of control. Tet promoters Tetracycline-dependent promoters are engineered by placing tet response elements... Fig. 2 Tetracycline on/off promoters and modes of action Check out Addgene's Lentiviral Tet-on and AAVS1... to control when you turn off expression for good, the Cre-Lox system offers inducible yet permanent gene...proteins while tet-on turns on constitutively silenced proteins. Addition of tetracycline or one of its...Turn it on? Turn it off? Turn it down, but not forever? You don’t need to resort to the force to control... -
Tetracycline Inducible Expression
TypeCollection...Collections Tetracycline (Tet) Inducible Expression Tetracycline (Tet) Inducible Expression Additional Resources...Collections Background Tetracycline Off Tetracycline On Experimental Tips Tet Plasmids Background To advance the...developed is known as tetracycline off: in the presence of tetracycline, expression from a tet-inducible promoter...Description Co-expressed tTA, rtTA, or TetR On or Off PI 21916 Tet-pLKO-neo 3rd generation lentiviral plasmid...Bujard tested the tet system in a mammalian cell system (HeLa) and found that the tet system was functional...Tips Choosing a tet system If your gene of interest should be active, and only turned off occasionally, ...Either Vogelstein 100521 pCW57.1-MAT2A Lentiviral Tet-Off all in one plasmid derived from pCW57.1. rtTA was... -
Quick Guide to All Things Lentivirus
TypeBlog Post...is the tetracycline (Tet)-regulated system. You can choose either the Tet-off system or the Tet-on system...system. In the Tet-off system a Tet-response element (TRE) is placed upstream of the promoter in your transfer...expression kinetics as compared to the Tet-off system. One drawback of the Tet system is that it often requires... In the absence of tetracycline or a derivative such as Doxycycline (Dox), the Tet-controlled transactivator... one containing the gene of interest (pTet-IRES-EGFP, pPRIME-Tet-GFP-FF3) and one with either tTA or rtTA...repress transgene expression. In contrast, in the Tet-on system, tTA has been modified (and renamed rtTA..., the third-generation lentiviral vector system offers the best safety profile in terms of RCL generation... -
Plasmids 101: Inducible Promoters
TypeBlog Post...inducible promoters. The positive inducible tetracycline ON (Tet-On) system, a versatile tool developed for...Addgene.org: Inducible Promoters for Bacteria Tetracycline (Tet) On Expression Systems at Addgene Cre-lox ...inducible promoters, which can be switched from an OFF to an ON state, and how you might use these in your...positive or negative control. Positive inducible In the OFF state, the promoter is inactive because the activator...initiating transcription. Negative inducible In the OFF state, the promoter is inactive because a bound repressor...lot. If you’re looking for high inducibility, the Tet-On system may be a good choice, as it’s documented...require only the addition of an external inducer, like Tet systems, may be activated very rapidly. In contrast... -
AAV Molecular Tools
TypeCollection...available from Addgene's viral service encoding tet-off transactivators and tools for affinity purification...pAAV-CAG-tTA CAG-driven, constitutive Expression of the tet-off transactivator (tTA) 2 Gradinaru 99120 pAAV-ihSyn1...Inducible Synapsin promoter (ihSyn) Expression of the tet-off transactivator (tTA) with a positive feedback loop...promoter (ihSyn) Cre-dependent expression of the tet-off transactivator (tTA) with a positive feedback loop...can be used with tetracycline (tet)-inducible expression systems . ID Name Expression System Activity ...TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible Cre-dependent, Tet-inducible expression of EYFP 1...Tools Tetracycline Transactivators Affinity Purification Neurophysiology Cell Ablation Tetracycline Transactivators... -
Simple CRISPR-based Epigenetic Editing: dCas9-directed DNA Demethylation
TypeBlog Post...before. But other enzymatic fusions, such as dCas9-TET, can, like the iron ball-and-chain that they resemble...there are a number of drawbacks to this approach: TET proteins are not demethylases; they are dioxygenases...dCas9 targeting (Galonska 2018). This means that off-target loci – in neighboring chromatin or throughout...Szyf 2021, Charlton et al. 2020). Most importantly, TET proteins affect transcription independent of their...2018, Kaas et al. 2013). Figure 2: CRISPR TET-based epigenetic editing. In reality, editing your...demethylation can be achieved by dCas9 alone, without TET (or any demethylase) fusion. This may seem counterintuitive...demethylation without the confounds inherent to dCas9-TET, allowing one to study the causal relationship between... -
15 Years of Addgene: The Top 15 Plasmids
TypeBlog Post...plasmids. Find pLKO.1 - TRC cloning vector. Tet-pLKO-puro - Tet-pLKO-puro contains all the necessary elements...Trono lab that expresses the HIV gag, pol, rev, and tet genes. It can be used with 2nd or 3rd generation ...gene knockdown. Note: this plasmid was called pLKO-Tet-On in the original publication but its name was subsequently...clarify that it does not contain the trademarked Tet-On(R) sold by Clontech. For additional information...the manual provided by the Weiderschain lab. Find Tet-pLKO-puro. lentiGuide-Puro - This plasmid expresses...adventures...From moving office locations three times, to opening our UK office in 2014, to starting our... of shRNA in target cells by the addition of tetracycline/doxycycline to the grown media resulting in ... -
Cre-lox system
TypeCollection... pBS537 tet-hCMV-GFPcre tet inducible Cre-GFP fusion tet-hCMV Mammalian Sauer 11961 pBS596 tet-hCMV-GFPcre...none Mammalian Sauer 11957 pBS595 tet-hCMV-EGFPcre Cre-EGFP fusion Tet inducible Mammalian Sauer 11958 ... which reporters are initially OFF and then probabilistically ON or OFF following Cre recombination to...Supernova TRE AAV Iwasato 85577 pTC-CMV-Tet CreER expression and tetracyclin-dependent transgene/shRNA expression...ApoE.HCR.hAAT Mammalian Ehmer 85578 pTC-ApoE-Tet CreER expression and tetracyclin-dependent transgene/shRNA expression...tet-hCMV-GFPcre tet inducible Cre-GFP fusion, metallothionein MT-I region including the polyadenylation site and...and several introns tet-hCMV Mammalian Sauer 12168 pMB80 (R26-CreER) Cre-ERT2 with loxp cassette; Targeting... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...-MCS-EGFP - Tet-inducible Find more Tet-inducible empty backbones on our Tetracycline (Tet) Inducible ...vector for mammalian genome editing Tet-pLKO-puro and Tet-pLKO-neo - Tet-inducible lentiviral shRNA expression...Expresses ultraID in mammalian cells with the Tet-On or Tet-Off system Return to top Selectable Markers Regardless...Backbones Neomycin (G418) Mammalian, Varies Tet-pLKO-neo - Tet-inducible lentiviral shRNA expression Find...Neomycin selection Puromycin Mammalian Tet-pLKO-puro - Tet-inducible lentiviral shRNA expression...vector with N- or C-terminal HA tag pInducer20 - Tet-inducible HA-tagged lentiviral vector for ORF expression...vector for gene expression pLenti CMV/TO Zeo DEST - Tet-inducible lentiviral Gateway destination vector for... -
AAVs CREATed for Gene Delivery to the CNS and PNS
TypeBlog Post...proteins under the control of an inducer, i.e. tet-off transactivator (tTA), is injected at a high dose...labeled. Part 2: An AAV expressing the inducer (i.e. tet-off transactivator) is co-injected. The dose of this... -
New Viral Vectors - Summer 2024
TypeBlog Post... promoter. Use this for doxycycline inducible (tet-off) gene expression! We've also added AAV1 and AAV5...vectors repository since March. Addgene is now offering an AAV2 CAG-driven tTA expresser from the Gradinaru...PdCO, deposited by the Yizhar lab. Addgene is now offering AAV1 and AAV5 preparations of several variants... -
Delivery Methods for Generating iPSCs
TypeBlog Post...iPSC-derived and iPSC-transplanted mice. Cre-deletable or Tet-inducible lentiviruses address some of these concerns...following reprogramming. This can be overcome by using a Tet-inducible virus to allow for controlled expression...out the links at the end of the post for a list of Tet-inducible reprogramming vectors available from Addgene...alteration as possible, with efficiency being the trade-off. Non-integrating approaches, such as episomes, RNA...Check out these plasmids if you’re interested in Tet-inducible lentiviral expression of OSKM reprogramming...test for mouse iPSCs, tetraploid complementation, involves injecting tetraploid blastocysts with iPSCs...the plasmid in mammalian cells and assists in tethering the vector to the cell’s chromosomes. With the... -
Using Addgene's New Viral Service for Your Research
TypeBlog Post...delivering control shRNAs, GFP, and rtTA from the Tet-on system. The first two can serve as controls in...activate expression of a gene under the control of the tet operator. AAV AAVs are the workhorses of both chemo... service: "I'm excited that Addgene is now offering virion preparations to the scientific community... -
Plasmids 101: E. coli Strains for Protein Expression
TypeBlog Post...ompT gal sulA11 R(mcr-73::miniTn10--TetS)2 [dcm] R(zgb-210::Tn10--TetS) General protein expression m15...Changing media is tricky, because there can be a trade-off between growth rate and protein quality. For many... gal dcm araB::T7RNAP-tetA General protein expression BLR (DE3) Tetracycline RecA-deficient; best ...not recommended for toxic proteins BL21-A1 Tetracycline Arabinose-inducible expression of T7 RNAP; IPTG...hsdSB (rB- mB-) gal dcm (DE3) Δ(srl-recA)306::Tn10 (TetR) Expression of unstable proteins HMS174 (DE3...proteins Origami2 (DE3)** Streptomycin and Tetracycline Contains highly active thioredoxin reductase...′[lac+ lacIq pro] (DE3) gor522::Tn10 trxB (StrR, TetR) Expression of insoluble proteins Rosetta2 (... -
Reaching out to China: Canton Nucleic Acids Forum (CNAF) 2015
TypeBlog Post...technical developments. Using the Tet-on system, his lab has created a tetracycline cas9 inducible knock-out system...Genome Research Institute (NHGRI) of the NIH, started off with the first keynote presentation. He talked about...remember when small RNA was just something we ran off the bottom of the gel so it wouldn’t muck up northern...interdisciplinary team. Day two of the conference was kicked off by Nobel Laureate (and Addgene depositor) Craig Mello... -
Plan Your Experiment
TypeCollection...sites are called off-targets and should be examined during gRNA design. In general, off-target sites are...reagents may be more appropriate. In cases where off-target editing is a major concern, Cas9-gRNA ribonucleoprotein... constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically used for gRNA May contain...window of CRISPR component expression may decrease off-target effects Can be used to generate transgenic...components Short window of CRISPR activity may decrease off-target effects Additional Resources: CRISPR protocols...nearby. Select gRNAs based on predicted on-target and off-target activity A PAM sequence is absolutely necessary...using a high-fidelity Cas enzyme. In addition to off-target activity , it is also important to consider... -
Plasmids 101: The Promoter Region – Let's Go!
TypeBlog Post... several tetracycline operators. Transcription can be turned on or off depending on what tet transactivator...development or there may be ways to turn them on or off at will with a chemical, heat, or light. In the cell.... coli tryptophan operon Repressible Gets turned off with high levels of cellular tryptophan. lac General...General expression mRNA Tetracycline response element promoter Inducible with Tetracyline or its derivatives... -
CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More
TypeBlog Post...and its ability to multiplex repression. Using a Tet responsive promoter to drive expression of a catalytically...pRH2521, respectively. Both dCas9 and the gRNA are Tet-inducible, and a gRNA can be cloned easily into pRH2521...knockdown and developed new, more tightly controlled, Tet responsive promoters to avoid leaky activation of...by L-arabinose and anhydrotetracycline (aTet), respectively. pMAZ-SK contains an aTet-inducible gRNA and...self-destruction" after induction with L-rhamnose and aTet. CRMAGE is much more efficient than traditional ...promoters or direct gene knockout. In contrast, CRISPR offers a much more user-friendly way to modulate gene ...presence of the inducer, in this case anhydro-tetracycline (aTc). By cloning in two tandem copies of the... -
Hot Plasmids - November 2023
TypeBlog Post...editors, but just as effective and with no additional off-target edits, making them ideal for size-limited ... By Alyssa NeuhausTo improve delivery and reduce off-target effects of gene therapy, Feng Zhang’s lab ...induced GFP-iPAK4 expressed under promoters like the tet-responsive element (TRE) or the cFos promoter. For...Importantly, even commercial antibodies can be tethered on the viral surface, expanding the range of targetable... to reduce negative side effects. This platform offers a promising approach for experimental therapies... -
Overcoming the Challenges of Lentiviral Production
TypeBlog Post...packaging systems, this system incorporates the Tet-off transcriptional activation system to drive high...associated with producing and using lentivirus and offer some tips and tricks for overcoming these hurdles...Guide. While the third generation packaging systems offer an extra level of safety, they also require a fourth... -
22 Hot Plasmid Technologies from 2014
TypeBlog Post...has used an inducible MitoTimer reporter using a Tet-on system (pTRE-Tight-MitoTimer) to show its usefulness...peptide-peptide ligation using SpyLigase Building off their SpyTag/SpyCatcher system for protein-peptide...mutagenesis (K176R) to improve the otherwise slow off-kinetics (15.8 ± 0.4ms from 21.4 ± 1.1 ms); this ...duration. Both of these strategies carry the risk of off-target effects. Harald Janovjak and his team at the...RUSH) use Cre-mediated recombination to turn on or off the expression of shRNA. This system requires less...expression. The capability to turn RUSH and CRUSH alleles off or on enables this method to rapidly address questions...repressor plasmids from Scot Wolfe's lab. These include Tet-inducible CRISPR activators and repressor plasmids... -
Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior
TypeBlog Post...incorporating a Tet-Off system to boost XFP expression. The increased brightness of Tetbow allows this system... proliferating cells. Tetbow optimizes Brainbow for current technologies Tetbow (Sakaguchi et al., 2018...fluorophores RFP (red), YFP (yellow), and membrane-tethered CFP (cyan). Brainbow 1.1 adds OFP (orange) (Livet...Flp recombinase. The XFPs in Flybow are membrane-tethered, making this system useful for visualization of...discriminating neurons within only one field of view. Tetbow can be introduced in vivo either by electroporation...vectors. The Imai lab also developed a version of Tetbow that incorporates chemical tags instead of XFP ...this blog post from the researchers who developed Tetbow. Conclusion Stochastic multicolor cell labeling... -
Your Lentiviral Plasmid FAQs Answered
TypeBlog Post...including cDNA expression, shRNA-mediated knockdown, Tet and Cre-regulated expression, CRISPR genome editing...; however, the 3rd-generation packaging systems offer the maximal biosafety available for the technology... -
CRISPR Guide
TypeCollection...increase specificity, and decrease off-target effects Sniper-Cas9 - less off-target activity; compatible with...cleaving only one strand of target dsDNA. Off-target effects or off-target activity Cas9 cleavage at undesired...of partial homology throughout the genome, called off-targets, that can impact your experiment. There are...DSB within the target DNA, it’s unlikely that two off-target nicks will be generated close enough to cause... mutating specific amino acid residues to reduce off-target editing. Some mutations disrupt interactions...method, increased fidelity enzymes generate less off-target editing than wild type Cas9. Examples of increased...proofreading and discrimination evoCas9 - decrease off-target effects xCas9 3.7 - mutations in multiple ... -
Neurodegeneration Research Collection
TypeCollection... bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression of transcription factors for...progression of Huntington’s disease. The foundation offers curated information on tools and reagents (Link... -
Validated gRNA Sequences
TypeCollection...24360272 Qi TET S. cerevisiae ACTTTTCTCTATCACTGATA 62313 scaffold S. pyogenes 25533786 Qi & Lim TET promoter... 26627737 Moffat PSMD1 H. sapiens TGTGCGCTACGGAGCTGCAA 74180 cut S. pyogenes 26627737 Moffat PSMD1 H. ... 26627737 Moffat PSMB2 H. sapiens ATGTTCTTGTCGCCTCCGAC 74184 cut S. pyogenes 26627737 Moffat PSMB2 H. ... 26627737 Moffat EIF3D H. sapiens TGTAGGTTGCCTCCATGGCC 74187 cut S. pyogenes 26627737 Moffat EIF3D H. ...pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737 Moffat AMPK alpha 1...TATCAGTGATAGAGAAAAGT 46923 interfere S. pyogenes 23849981 Weissman Tet3G synthetic GTACGTTCTCTATCACTGATA 62327 activate/interfere... -
Plan Your Experiment
TypeGuide...sites are called off-targets and should be examined during gRNA design. In general, off-target sites are...reagents may be more appropriate. In cases where off-target editing is a major concern, Cas9-gRNA ribonucleoprotein... constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically used for gRNA May contain...window of CRISPR component expression may decrease off-target effects Can be used to generate transgenic...components Short window of CRISPR activity may decrease off-target effects Additional Resources: CRISPR protocols...nearby. Select gRNAs based on predicted on-target and off-target activity A PAM sequence is absolutely necessary...using a high-fidelity Cas enzyme. In addition to off-target activity , it is also important to consider... -
What's New in CRISPR - March 2020
TypeBlog Post...Cas9-independent off-target DNA editing, ~5–50-fold lower levels of Cas9-dependent off-target DNA editing...repressor plasmids Cytosine base editors with minimized off-target DNA editing The original cytosine base editor...editor, BE3, induces a low frequency of genome-wide off-target DNA editing. Using several rapid and cost-... RNA-guided methylcytosine editing by TET1 by co-delivering TET1 and protein factors for linking methylcytosine...., 2019. Fusing epigenetic modifiers such as TET1 with inactive Cas enzymes can alter gene expression... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Expression Jump to Top Photoswitchable (e.g. off to on to off) Protein Excitation (nm) Emission (nm) Brightness...Mammalian Expression Jump to Top Photoactivatable (e.g. off to on) Excitation and Emission wavelengths after ...eqFP611 559 611 35 Tetramer eqFP611-N1 - Mammalian Expression DsRed2 563 582 24 Tetramer pCAG-DsRed2 - Mammalian...CYPet-C1 - Mammalian Expression AmCyan1 453 486 11 Tetramer AmCyan1-N1 - Mammalian Expression MiCy (Midoriishi-Cyan...Expression (cysteine-free SGFP2) ZsGreen 493 505 39 Tetramer pHIV-Zsgreen - Mammalian Expression (this is a...YPet-pBAD - Bacterial Expression ZsYellow1 529 539 8 Tetramer ZsYellow1-N1 - Mammalian Expression mPapaya1 530...Expression Kaede 508 / 572 518 / 580 87 / 20 5.6/5.6 Tetramer Kaede-N1 - Mammalian Expression Kaede-C2 - Mammalian... -
CRISPR 101: Anti-CRISPR Proteins Switch Off CRISPR-Cas Systems
TypeBlog Post...experiments 1. Reduce off-target effects Prolonged Cas activity can increase the chance of off-target editing...be used to limit this off-target editing, but when is the best time to shut off Cas activity? Using inhibitor... vectors. Having a way to shut off CRISPR-Cas systems prevents the off-target effects and cytotoxicity... to flip the switch and turn off CRISPR activity. The ability to turn off CRISPR activity is an important...there’s one thing that was missing: a way to shut off Cas’s activity. The concern is that the longer Cas...active in a cell, the greater chances there are for off-target edits to occur. Although methods to switch... drugs have been developed, the field lacked an “off-switch” for Cas proteins. Discovery of anti-CRISPR... -
New Optimized Genome-wide CRISPRko, CRISPRi, and CRISPRa Libraries
TypeBlog Post...designed to improve on-target activity while reducing off-target effects in human genomes (Doench et al., 2016...based on their optimized sgRNA rules and potential off-target effects. The Dolcetto library contains two...previously established sgRNA rules and potential on- and off-target effects. The 6 best sgRNAs were selected per...Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9." Nature biotechnology...while nuclease-deactivated Cas9 (dCas9) can be tethered to a repressor (CRISPRi) or an activation domain...RNA-guided DNA binding protein (dCas9). dCas9 is then tethered to a repressive domain, such as KRAB, to prevent... -
Better Dyeing Through Chemistry & Small Molecule Fluorophores
TypeBlog Post... Other strategies that have been developed based off of this concept include: Self-labeling tags (e.g...cons All of these labeling strategies have trade-offs between the size of the genetically encoded tag,...discovered in 1856 by William Perkin. His discovery set off a flurry of activity and the majority of the classic...FlAsH, ReAsH) and a short genetically encoded tetracysteine (Cys4) peptide tag could be used to label proteins... lipoic acid ligase, biotin ligase, phosphopantetheinyltransferase) – These enzymes catalyze the covalent...1c). Click chemistry (e.g., transcyclooctene–tetrazine)– Nonnatural amino acids can be incorporated into... -
Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens
TypeBlog Post... typically achieve 90-99% knockdown with minimal off-target effects. The system also enabled them to turn...system. First of all, the Cas9s can be turned on and off, to reversibly activate or repress genes of interest...RNAs have different abilities to turn genes on and off,” he said. “Some are strong and some more moderate...where the degree to which genes are turned on and off varies depending on which guide RNA we use. What ...sgRNA incorporating two MS2 RNA aptamers at the tetraloop and stem-loop 2; 3. The MS2-P65-HSF1 plasmid which... -
Viral Vectors 101: Optogenetic Tools
TypeBlog Post... of light, with a different wavelength, turns it off, allowing the cell to be excited over a sustained...tools in their experiments. Some tools turn on and off rapidly with light to control precise timing of the...and activation kinetics Some channels turn on and off very rapidly in response to a single light pulse ...of how each tool performs and the consequences of off-target activity. Whether you are studying neuronal...photoswitchable tethered ligands (PTL), and photoswitchable, orthogonal, remotely-tethered ligands (PORTLs... secondary signaling pathways. Photoswitchable tethered ligands hold the ligand in close proximity to ... -
Visualizing Translation at the Single Molecule Level
TypeBlog Post...TRICK (Translating RNA Imaging by Coat protein Knock-off) instead takes advantage of the ribosome’s movement...yellow. The act of translation pushes NLS-PCP-GFP off of the mRNA, leaving only a red FP bound to the reporter...NLS-MS2-RFP) the reporter mRNA, which contains the tethering sites for the fluorescent proteins and is driven...of the PP7 and MS2 coat protein binding sites to tether many copies of the FP-coat protein fusions to their...these papers did. Since the SunTag-based system tethers mRNAs to the plasma membrane, it’s not appropriate... -
Lighting Up Cell Signaling with Photoswitchable Kinases
TypeBlog Post... In this system, light is used to turn “on” and “off” MEK1 activity by attaching two dimerizing photoswitchable... the Dronpa dimers interact and lock MEK1 in an “off” setting by blocking the active site. Dronpa also... thus indicates MEK1’s current state (Green when off, dark when on). Figure 1: Photoswitchable MEK1 (...psRaf1) followed by 3 seconds of 400 nm light (turn off psRaf1). After this, the phosphorylation status of...prone to aggregation in cells compared to the tetrameric Dronpa it was derived from. What are photoswitchable... -
CRISPR Plasmids - Bacteria
TypeCollection...NHEJ). Double nicking strategies reduce unwanted off-target effects. Nickase mutants can also be used ...Publication 64325 3xFLAG-dCas9/p-bacteria 3xFLAG-dCas9 pLtetO-1 Fujii Efficient isolation of specific genomic... -
What's New in CRISPR - December 2019
TypeBlog Post...cytosine base editors, which decrease the rate of off-target genome edits compared to rat APOBEC1. Now,...CRISPR/Cas9 in cells has advantages like reduced off-target activity and decreased immune response to ...ribonucleoproteins for transient expression. They replaced the tetraloop of the sgRNA scaffold with a com aptamer which... -
CRISPR Plasmids - Mammalian Expression
TypeCollection...NHEJ). Double nicking strategies reduce unwanted off-target effects. Nickase mutants can also be used ... by DNMT3A or MQ1, and cytosine demethylation by Tet1. These modifications persist over time and are potentially... -
Viral Vectors 101: AAV Variables That Matter
TypeBlog Post...) the consequences to your experiment if there’s off-target expression. Once you know that, you’re ready...tyrosine-hydroxylase (TH), can limit which cells express your gene. Off-target expression can still occur (Fig. 3) - for ... two astrocyte selective promoters demonstrating off-target expression in both oligodendrocytes (Olig2...promoter allows you to decide when to turn on, or turn off, gene expression by administering an inducing agent... Finally, the risks of potential toxicity and/or off-target effects (e.g. recombinase-dependent vectors...Ubiquitous promoters These often-strong promoters offer the most flexibility for expression in a large number...2002). Lack of an Immune Response against the Tetracycline-Dependent Transactivator Correlates with Long-Term... -
Fluorescent Protein Travel Awards - FLiPs and Fluorescent Protein Biosensors
TypeBlog Post...on and off with light. Xin hypothesized that she could make enzymes controllable by tethering them to...thereby occluding the enzyme active site and shutting off the enzyme. Later exposure to cyan light stopped ... -
What's New in CRISPR - May 2019
TypeBlog Post... in the rat APOBEC1 that decreases the number of off-target RNA edits by >390 fold and >3,800 fold in .... coli genome-wide CRISPR inhibition Covalent tethering of DNA template to Cas9 SECURE base editors Nme2Cas9...genome-wide CRISPR inhibition library Covalent tethering of DNA repair template to Cas9 Homology-directed... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post... temporally control which genes are turned on or off in a given area and the can do so in a very specific...gene expression studies, which are evinced by the Tet system and visualization of single molecules via ... which allow you to easily and reversibly switch off and on your favourite signalling pathways (Figure...of the ribosome during translation, which knocks off all mRNA binding proteins as it travels along the...for Translation RNA Imaging by Coat protein Knock-off, is made up of three components: a GFP protein that...NLS-MS2-RFP) the reporter mRNA, which contains the tethering sites for the fluorescent proteins and an inducible...however, remain bound to the mRNA since they are tethered AFTER the stop codon. Thus a non-translated mRNA... -
Mouse Modeling, Part 1: Genetically Engineered Mice
TypeBlog Post...some challenges still exist. Nucleases may cause off-target effects on regions of the genome with similar...either induce or repress Cre expression using TetON or TetOFF systems. So now hopefully creating a genetically... the cell can occur. Similar systems include tetracycline or doxycycline mediated activation of Cre to... -
Let There Be LITE Plasmids
TypeBlog Post...designed to bind specific genes and turn them on or off, literally at the flip of a (blue) light switch. ...chromophores flavin-adenine dinucleotide and methyltetrahydrofolate, which are universally abundant. Second...apply LITEs for the transformation of neurons, she offers a tip: save yourself some time by making an AAV1... -
Bacterial Expression Systems
TypeCollection...PR, pLtetO, pLlacO Arabinose, Anhydrotetracycline, lactose, IPTG Richard Murray Plasmids based off of ... pdCas9-bacteria 44249 pTetO Anhydrotetracycline Stanley Qi Anhydrotetracycline inducible expression of... light. pCph8 50552 pLtetO-1 Anhydrotetracycline Jeffrey Tabor Anhydrotetracycline inducible expression...pwtCas9-bacteria 44250 CRISPR Stanley Qi Anhydrotetracycline inducible expression of wild-type Cas9 from... -
Teaching an Old DOG New Tricks: Controlling Protein Activity with GFP
TypeBlog Post... GFP-binding nanobodies, the project really took off. Unlike most antibodies, nanobodies, which occur ...DNA-binding domains, including the commonly used LexA and rTetR systems such that they activate gene expression ...advantages. T-DOGGs can be made drug-inducible using the rTetR system, but Cre-DOG lacks the toxicity that can ... -
New CRISPR Web Resources and #12DaysofCRISPR Recap
TypeBlog Post... on-target activity to siRNA, but with far fewer off-target effects! This characteristic probably explains... by DNMT3A or MQ1, and cytosine demethylation by Tet1. RNA Targeting: This page contains Cas13 constructs... -
The Blue Flame Award: Celebrating Addgene's Most Requested Depositors
TypeBlog Post...receive your award, we’d love to see you show it off! To share your photo, tag @Addgene and #happydepositor... the world from the far-eastern islands,” said Tetsushi Sakuma, a lecturer at Hiroshima University who...