Skip to main content

We narrowed to 79 results for: tet off

Showing: 1 - 50 of 79 results
  1. Plasmids 101: Repressible Promoters

    Type
    Blog Post
    ...2nd generation Tet-Off vectors (Tet-Advanced)” are the most recent variants of the Tet-Off system.  For ...gene-function/tet-inducible-expression-systems/tet-systems-legacy-products/tet-on-and-tet-off-2nd-generation...10.1101/gad.2.6.718. PMID: 2843425.Takara Bio. Tet-On and Tet-Off systems: Second generation. https://www.takarabio.com...promoters Tet-Off In its native context, the tetracycline repressor (TetR) can bind to the tetracycline operator...promoter and turning transcription OFF. Despite their bacterial origins, Tet systems function well in mammalian... post. In the past 30 years since the original Tet-Off system was described by Gossen and Bujard, both...operator sequences (TetO), preventing transcription. In the presence of tetracycline (Tet), TetR preferentially...
  2. Plasmids 101: The protein expression toolbox

    Type
    Blog Post
    ...come in two varieties: tet-on and tet-off. As the names imply, tet-off turns off constitutively expressed...options together. Turn it off Turn it off forever If you want to turn off protein expression, you are...of control. Tet promoters Tetracycline-dependent promoters are engineered by placing tet response elements... Fig. 2 Tetracycline on/off promoters and modes of action Check out Addgene's Lentiviral Tet-on and AAVS1... to control when you turn off expression for good, the Cre-Lox system offers inducible yet permanent gene...proteins while tet-on turns on constitutively silenced proteins. Addition of tetracycline or one of its...Turn it on? Turn it off? Turn it down, but not forever? You don’t need to resort to the force to control...
  3. Tetracycline Inducible Expression

    Type
    Collection
    ...shown. Tetracycline Off (Tet-Off) The first major advance was the Tet-Off system. A tetracycline-controlled... of tet-responsive systems: Tet-Off and Tet-On. Read on to learn more about the components of tet systems... center: Tet-Off; right: Tet-On. TRE: Tet response element; tTA: tetracycline-controlled transactivator...active and only turned off occasionally, use Tet-Off: express a tTA and include a tet-responsive promoter...promoter, for Tet-Off. See Plasmid #27106 for rtTA. tTA Edward Hsiao 99118 pAAV-CAG-tTA AAV Tet-Off vector, ... CAG promoter for Tet-Off tTA-Advanced Takeshi Imai 104109 pAAV-Syn1-tTA AAV Tet-Off vector, expressed...can serve as either Tet-Off or Tet-On systems, depending on whether they are used alongside a tTA or rtTA...
  4. Quick Guide to All Things Lentivirus

    Type
    Blog Post
    ...is the tetracycline (Tet)-regulated system. You can choose either the Tet-off system or the Tet-on system...system. In the Tet-off system a Tet-response element (TRE) is placed upstream of the promoter in your transfer...expression kinetics as compared to the Tet-off system. One drawback of the Tet system is that it often requires... In the absence of tetracycline or a derivative such as Doxycycline (Dox), the Tet-controlled transactivator... one containing the gene of interest (pTet-IRES-EGFP, pPRIME-Tet-GFP-FF3) and one with either tTA or rtTA...repress transgene expression. In contrast, in the Tet-on system, tTA has been modified (and renamed rtTA..., the third-generation lentiviral vector system offers the best safety profile in terms of RCL generation...
  5. Plasmids 101: Inducible Promoters

    Type
    Blog Post
    ...inducible promoters. The positive inducible tetracycline ON (Tet-On) system, a versatile tool developed for...Addgene.org: Inducible Promoters for Bacteria Tetracycline (Tet) Inducible Systems at Addgene Cre-lox Guide...inducible promoters, which can be switched from an OFF to an ON state, and how you might use these in your...positive or negative control. Positive inducible In the OFF state, the promoter is inactive because the activator...initiating transcription.     Negative inducible In the OFF state, the promoter is inactive because a bound repressor...lot. If you’re looking for high inducibility, the Tet-On system may be a good choice, as it’s documented...require only the addition of an external inducer, like Tet systems, may be activated very rapidly. In contrast...
  6. Simple CRISPR-based Epigenetic Editing: dCas9-directed DNA Demethylation

    Type
    Blog Post
    ...before. But other enzymatic fusions, such as dCas9-TET, can, like the iron ball-and-chain that they resemble...there are a number of drawbacks to this approach: TET proteins are not demethylases; they are dioxygenases...dCas9 targeting (Galonska 2018). This means that off-target loci – in neighboring chromatin or throughout...Szyf 2021, Charlton et al. 2020). Most importantly, TET proteins affect transcription independent of their...2018, Kaas et al. 2013). Figure 2: CRISPR TET-based epigenetic editing. In reality, editing your...demethylation can be achieved by dCas9 alone, without TET (or any demethylase) fusion. This may seem counterintuitive...demethylation without the confounds inherent to dCas9-TET, allowing one to study the causal relationship between...
  7. AAV Molecular Tools

    Type
    Collection
    ...available from Addgene's viral service encoding tet-off transactivators and tools for affinity purification...pAAV-CAG-tTA CAG-driven, constitutive Expression of the tet-off transactivator (tTA) 2 Viviana Gradinaru 99120 ...Inducible Synapsin promoter (ihSyn) Expression of the tet-off transactivator (tTA) with a positive feedback loop...promoter (ihSyn) Cre-dependent expression of the tet-off transactivator (tTA) with a positive feedback loop...tools/controls and tetracycline transactivators that can be used with tetracycline (tet)-inducible expression...TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible Cre-dependent, Tet-inducible expression of EYFP 1...Overexpression Tracers Tetracycline Transactivators and Inducible Tools These AAV encode tetracycline-inducible tools...
  8. 15 Years of Addgene: The Top 15 Plasmids

    Type
    Blog Post
    ...plasmids. Find pLKO.1 - TRC cloning vector. Tet-pLKO-puro - Tet-pLKO-puro contains all the necessary elements...Trono lab that expresses the HIV gag, pol, rev, and tet genes. It can be used with 2nd or 3rd generation ...gene knockdown. Note: this plasmid was called pLKO-Tet-On in the original publication but its name was subsequently...clarify that it does not contain the trademarked Tet-On(R) sold by Clontech. For additional information...the manual provided by the Weiderschain lab. Find Tet-pLKO-puro. lentiGuide-Puro - This plasmid expresses...adventures...From moving office locations three times, to opening our UK office in 2014, to starting our... of shRNA in target cells by the addition of tetracycline/doxycycline to the grown media resulting in ...
  9. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...-MCS-EGFP - Tet-inducible Find more Tet-inducible empty backbones on our Tetracycline (Tet) Inducible ...vector for mammalian genome editing Tet-pLKO-puro and Tet-pLKO-neo - Tet-inducible lentiviral shRNA expression...Expresses ultraID in mammalian cells with the Tet-On or Tet-Off system Return to top Selectable Markers Regardless...Backbones Neomycin (G418) Mammalian, Varies Tet-pLKO-neo - Tet-inducible lentiviral shRNA expression Find...Pur - Eukaryotic expression vector Tet-pLKO-puro - Tet-inducible lentiviral shRNA expression...expression vector with N-terminal HA tag pInducer20 - Tet-inducible HA-tagged lentiviral vector for ORF expression...vector for gene expression pLenti CMV/TO Zeo DEST - Tet-inducible lentiviral Gateway destination vector for...
  10. AAVs CREATed for Gene Delivery to the CNS and PNS

    Type
    Blog Post
    ...proteins under the control of an inducer, i.e. tet-off transactivator (tTA), is injected at a high dose...labeled. Part 2: An AAV expressing the inducer (i.e. tet-off transactivator) is co-injected. The dose of this...
  11. New Viral Vectors - Summer 2024

    Type
    Blog Post
    ... promoter. Use this for doxycycline inducible (tet-off) gene expression! We've also added AAV1 and AAV5...vectors repository since March.  Addgene is now offering an AAV2 CAG-driven tTA expresser from the Gradinaru...PdCO, deposited by the Yizhar lab. Addgene is now offering AAV1 and AAV5 preparations of several variants...
  12. Delivery Methods for Generating iPSCs

    Type
    Blog Post
    ...iPSC-derived and iPSC-transplanted mice. Cre-deletable or Tet-inducible lentiviruses address some of these concerns...following reprogramming. This can be overcome by using a Tet-inducible virus to allow for controlled expression...out the links at the end of the post for a list of Tet-inducible reprogramming vectors available from Addgene...alteration as possible, with efficiency being the trade-off. Non-integrating approaches, such as episomes, RNA...Check out these plasmids if you’re interested in Tet-inducible lentiviral expression of OSKM reprogramming...test for mouse iPSCs, tetraploid complementation, involves injecting tetraploid blastocysts with iPSCs...the plasmid in mammalian cells and assists in tethering the vector to the cell’s chromosomes. With the...
  13. Using Addgene's New Viral Service for Your Research

    Type
    Blog Post
    ...delivering control shRNAs, GFP, and rtTA from the Tet-on system. The first two can serve as controls in...activate expression of a gene under the control of the tet operator. AAV AAVs are the workhorses of both chemo... service: "I'm excited that Addgene is now offering virion preparations to the scientific community...
  14. Plasmids 101: E. coli Strains for Protein Expression

    Type
    Blog Post
    ...ompT gal sulA11 R(mcr-73::miniTn10--TetS)2 [dcm] R(zgb-210::Tn10--TetS) General protein expression  m15...Changing media is tricky, because there can be a trade-off between growth rate and protein quality. For many... gal dcm araB::T7RNAP-tetA General protein expression  BLR (DE3) Tetracycline RecA-deficient; best ...not recommended for toxic proteins BL21-A1 Tetracycline Arabinose-inducible expression of T7 RNAP; IPTG...hsdSB (rB- mB-) gal dcm (DE3) Δ(srl-recA)306::Tn10 (TetR) Expression of unstable proteins  HMS174 (DE3...proteins Origami2 (DE3)** Streptomycin and Tetracycline Contains highly active thioredoxin reductase...′[lac+ lacIq pro] (DE3) gor522::Tn10 trxB (StrR, TetR) Expression of insoluble proteins  Rosetta2 (...
  15. Reaching out to China: Canton Nucleic Acids Forum (CNAF) 2015

    Type
    Blog Post
    ...technical developments. Using the Tet-on system, his lab has created a tetracycline cas9 inducible knock-out system...Genome Research Institute (NHGRI) of the NIH, started off with the first keynote presentation. He talked about...remember when small RNA was just something we ran off the bottom of the gel so it wouldn’t muck up northern...interdisciplinary team.  Day two of the conference was kicked off by Nobel Laureate (and Addgene depositor) Craig Mello...
  16. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    ... several tetracycline operators. Transcription can be turned on or off depending on what tet transactivator...development or there may be ways to turn them on or off at will with a chemical, heat, or light. In the cell.... coli tryptophan operon Repressible Gets turned off with high levels of cellular tryptophan. lac General...General expression mRNA Tetracycline response element promoter Inducible with Tetracyline or its derivatives...
  17. CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More

    Type
    Blog Post
    ...and its ability to multiplex repression. Using a Tet responsive promoter to drive expression of a catalytically...pRH2521, respectively. Both dCas9 and the gRNA are Tet-inducible, and a gRNA can be cloned easily into pRH2521...knockdown and developed new, more tightly controlled, Tet responsive promoters to avoid leaky activation of...by L-arabinose and anhydrotetracycline (aTet), respectively. pMAZ-SK contains an aTet-inducible gRNA and...self-destruction" after induction with L-rhamnose and aTet. CRMAGE is much more efficient than traditional ...promoters or direct gene knockout. In contrast, CRISPR offers a much more user-friendly way to modulate gene ...presence of the inducer, in this case anhydro-tetracycline (aTc). By cloning in two tandem copies of the...
  18. Hot Plasmids - November 2023

    Type
    Blog Post
    ...editors, but just as effective and with no additional off-target edits, making them ideal for size-limited ...  By Alyssa NeuhausTo improve delivery and reduce off-target effects of gene therapy, Feng Zhang’s lab ...induced GFP-iPAK4 expressed under promoters like the tet-responsive element (TRE) or the cFos promoter. For...Importantly, even commercial antibodies can be tethered on the viral surface, expanding the range of targetable... to reduce negative side effects. This platform offers a promising approach for experimental therapies...
  19. Overcoming the Challenges of Lentiviral Production

    Type
    Blog Post
    ...packaging systems, this system incorporates the Tet-off transcriptional activation system to drive high...associated with producing and using lentivirus and offer some tips and tricks for overcoming these hurdles...Guide. While the third generation packaging systems offer an extra level of safety, they also require a fourth...
  20. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...has used an inducible MitoTimer reporter using a Tet-on system (pTRE-Tight-MitoTimer) to show its usefulness...peptide-peptide ligation using SpyLigase Building off their SpyTag/SpyCatcher system for protein-peptide...mutagenesis (K176R) to improve the otherwise slow off-kinetics (15.8 ± 0.4ms from 21.4 ± 1.1 ms); this ...duration. Both of these strategies carry the risk of off-target effects. Harald Janovjak and his team at the...RUSH) use Cre-mediated recombination to turn on or off the expression of shRNA. This system requires less...expression. The capability to turn RUSH and CRUSH alleles off or on enables this method to rapidly address questions...repressor plasmids from Scot Wolfe's lab. These include Tet-inducible CRISPR activators and repressor plasmids...
  21. Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior

    Type
    Blog Post
    ...incorporating a Tet-Off system to boost XFP expression. The increased brightness of Tetbow allows this system... proliferating cells. Tetbow optimizes Brainbow for current technologies Tetbow (Sakaguchi et al., 2018...fluorophores RFP (red), YFP (yellow), and membrane-tethered CFP (cyan). Brainbow 1.1 adds OFP (orange) (Livet...Flp recombinase. The XFPs in Flybow are membrane-tethered, making this system useful for visualization of...discriminating neurons within only one field of view. Tetbow can be introduced in vivo either by electroporation...vectors. The Imai lab also developed a version of Tetbow that incorporates chemical tags instead of XFP ...this blog post from the researchers who developed Tetbow. Conclusion Stochastic multicolor cell labeling...
  22. Your Lentiviral Plasmid FAQs Answered

    Type
    Blog Post
    ...including cDNA expression, shRNA-mediated knockdown, Tet and Cre-regulated expression, CRISPR genome editing...; however, the 3rd-generation packaging systems offer the maximal biosafety available for the technology...
  23. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Return to top Reversibly Photoswitchable (e.g. Off to On to Off) Protein Excitation (nm) Emission (nm) Activation...Structure Plasmids rsTagRFP 567 585 440 (Off to On) 567 (On to Off) 4.0 6.6 43 min Prone to dimerization ...Bacterial Expression iLOV 447 497 467 (On to Off) Spontaneous (Off to On) Monomer pEiLOV-N1 - Mammalian Expression...Mammalian Expression rsEGFP2 478 503 408 (Off to On) 503 (On to Off) 18 5.8 20 min pcDuex2-rsEGFP2-E - Mammalian...Bacterial Expression rsEGFP1 493 510 405 (Off to On) 491 (On to Off) 17 6.5 3 h rsGFP1-pBAD - Bacterial Expression...Expression Dronpa3 490 515 405 (Off to On) 490 (On to Off) 19 Monomer Dronpa3-N1 - Mammalian Expression...Mammalian Expression Dronpa 503 518 400 (Off to On) 503 (On to Off) 81 40 min Monomer pcDuex2-Dronpa - Mammalian...
  24. CRISPR Guide

    Type
    Collection
    ...increase specificity, and decrease off-target effects Sniper-Cas9 - less off-target activity; compatible with...cleaving only one strand of target dsDNA. Off-target effects or off-target activity Cas9 cleavage at undesired...of partial homology throughout the genome, called off-targets, that can impact your experiment. There are...DSB within the target DNA, it’s unlikely that two off-target nicks will be generated close enough to cause... mutating specific amino acid residues to reduce off-target editing. Some mutations disrupt interactions...method, increased fidelity enzymes generate less off-target editing than wild type Cas9. Examples of increased...proofreading and discrimination evoCas9 - decrease off-target effects xCas9 3.7 - mutations in multiple ...
  25. Neurodegeneration Research Collection

    Type
    Collection
    ... bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression of transcription factors for...progression of Huntington’s disease. The foundation offers curated information on tools and reagents (Link...
  26. Validated gRNA Sequences

    Type
    Collection
    ...24360272 Qi TET S. cerevisiae ACTTTTCTCTATCACTGATA 62313 scaffold S. pyogenes 25533786 Qi & Lim TET promoter... 26627737 Moffat PSMD1 H. sapiens TGTGCGCTACGGAGCTGCAA 74180 cut S. pyogenes 26627737 Moffat PSMD1 H. ... 26627737 Moffat PSMB2 H. sapiens ATGTTCTTGTCGCCTCCGAC 74184 cut S. pyogenes 26627737 Moffat PSMB2 H. ... 26627737 Moffat EIF3D H. sapiens TGTAGGTTGCCTCCATGGCC 74187 cut S. pyogenes 26627737 Moffat EIF3D H. ...pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737 Moffat AMPK alpha 1...TATCAGTGATAGAGAAAAGT 46923 interfere S. pyogenes 23849981 Weissman Tet3G synthetic GTACGTTCTCTATCACTGATA 62327 activate/interfere...
  27. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...Cre-lox can be used to turn shRNA constructs on or off. In floxed-shRNA constructs, Cre can excise the shRNA...utilize recombination elements such as Cre to turn off the expression of one gene while simultaneously turning...with lineage-specific drivers can also help reduce off-target events and the systemic effects of Cre toxicity...only activated in the presence of tamoxifen. A tetracycline-regulated or other drug-inducible approach may...
  28. What's New in CRISPR - March 2020

    Type
    Blog Post
    ...Cas9-independent off-target DNA editing, ~5–50-fold lower levels of Cas9-dependent off-target DNA editing...repressor plasmids Cytosine base editors with minimized off-target DNA editing The original cytosine base editor...editor, BE3, induces a low frequency of genome-wide off-target DNA editing. Using several rapid and cost-... RNA-guided methylcytosine editing by TET1 by co-delivering TET1 and protein factors for linking methylcytosine...., 2019. Fusing epigenetic modifiers such as TET1 with inactive Cas enzymes can alter gene expression...
  29. CRISPR 101: Anti-CRISPR Proteins Switch Off CRISPR-Cas Systems

    Type
    Blog Post
    ...experiments 1. Reduce off-target effects Prolonged Cas activity can increase the chance of off-target editing...be used to limit this off-target editing, but when is the best time to shut off Cas activity? Using inhibitor... vectors. Having a way to shut off CRISPR-Cas systems prevents the off-target effects and cytotoxicity... to flip the switch and turn off CRISPR activity. The ability to turn off CRISPR activity is an important...there’s one thing that was missing: a way to shut off Cas’s activity. The concern is that the longer Cas...active in a cell, the greater chances there are for off-target edits to occur. Although methods to switch... drugs have been developed, the field lacked an “off-switch” for Cas proteins. Discovery of anti-CRISPR...
  30. Luciferase Plasmid Collection

    Type
    Collection
    ...Luciferase Firefly TRE Lentiviral vector with dox- or tet-inducible luciferase expression Stephen Tapscott ...popular plasmids expressing luciferase. We also offer ready-to-use AAV preparations of select luciferase...expression of firefly luciferase William Kaelin 60495 pSBtet-GP Firefly TRE Dox-inducible expression of firefly...
  31. New Optimized Genome-wide CRISPRko, CRISPRi, and CRISPRa Libraries

    Type
    Blog Post
    ...designed to improve on-target activity while reducing off-target effects in human genomes (Doench et al., 2016...based on their optimized sgRNA rules and potential off-target effects. The Dolcetto library contains two...previously established sgRNA rules and  potential on- and off-target effects. The 6 best sgRNAs were selected per...Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9." Nature biotechnology...while nuclease-deactivated Cas9 (dCas9) can be tethered to a repressor (CRISPRi) or an activation domain...RNA-guided DNA binding protein (dCas9). dCas9 is then tethered to a repressive domain, such as KRAB, to prevent...
  32. Better Dyeing Through Chemistry & Small Molecule Fluorophores

    Type
    Blog Post
    ... Other strategies that have been developed based off of this concept include: Self-labeling tags (e.g...cons All of these labeling strategies have trade-offs between the size of the genetically encoded tag,...discovered in 1856 by William Perkin. His discovery set off a flurry of activity and the majority of the classic...FlAsH, ReAsH) and a short genetically encoded tetracysteine (Cys4) peptide tag could be used to label proteins... lipoic acid ligase, biotin ligase, phosphopantetheinyltransferase) – These enzymes catalyze the covalent...1c). Click chemistry (e.g., transcyclooctene–tetrazine)– Nonnatural amino acids can be incorporated into...
  33. Viral Vectors 101: Optogenetic Tools

    Type
    Blog Post
    ... of light, with a different wavelength, turns it off, allowing the cell to be excited over a sustained...tools in their experiments. Some tools turn on and off rapidly with light to control precise timing of the...and activation kinetics Some channels turn on and off very rapidly in response to a single light pulse ...of how each tool performs and the consequences of off-target activity. Whether you are studying neuronal...photoswitchable tethered ligands (PTL), and photoswitchable, orthogonal, remotely-tethered ligands (PORTLs... secondary signaling pathways. Photoswitchable tethered ligands hold the ligand in close proximity to ...
  34. Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens

    Type
    Blog Post
    ... typically achieve 90-99% knockdown with minimal off-target effects. The system also enabled them to turn...system. First of all, the Cas9s can be turned on and off, to reversibly activate or repress genes of interest...RNAs have different abilities to turn genes on and off,” he said. “Some are strong and some more moderate...where the degree to which genes are turned on and off varies depending on which guide RNA we use. What ...sgRNA incorporating two MS2 RNA aptamers at the tetraloop and stem-loop 2; 3. The MS2-P65-HSF1 plasmid which...
  35. Visualizing Translation at the Single Molecule Level

    Type
    Blog Post
    ...TRICK (Translating RNA Imaging by Coat protein Knock-off) instead takes advantage of the ribosome’s movement...yellow. The act of translation pushes NLS-PCP-GFP off of the mRNA, leaving only a red FP bound to the reporter...NLS-MS2-RFP) the reporter mRNA, which contains the tethering sites for the fluorescent proteins and is driven...of the PP7 and MS2 coat protein binding sites to tether many copies of the FP-coat protein fusions to their...these papers did. Since the SunTag-based system tethers mRNAs to the plasma membrane, it’s not appropriate...
  36. Lighting Up Cell Signaling with Photoswitchable Kinases

    Type
    Blog Post
    ... In this system, light is used to turn “on” and “off” MEK1 activity by attaching two dimerizing photoswitchable... the Dronpa dimers interact and lock MEK1 in an “off” setting by blocking the active site. Dronpa also... thus indicates MEK1’s current state (Green when off, dark when on). Figure 1: Photoswitchable MEK1 (...psRaf1) followed by 3 seconds of 400 nm light (turn off psRaf1). After this, the phosphorylation status of...prone to aggregation in cells compared to the tetrameric Dronpa it was derived from. What are photoswitchable...
  37. Bacterial Expression Systems

    Type
    Collection
    ...Controlled Expression Resources Check out our Tetracycline (Tet) Inducible Expression Collection for an extensive...Expression Species PI 44249 pdCas9-bacteria pTetO Anhydrotetracycline (aTc) Escherichia coli Stanley Qi 11518...coli Andreas Moeglich 68940 pRMC2 Pxyl/TetO Anhydrotetracycline (aTc) Staphylococcus aureus Tim Foster...glutamicum Timothy Lu 17972 pSE100 Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium...tuberculosis Sabine Ehrt 44561 pST-KT Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium...extorquens Christopher Marx 44448 pLC291 pR/TetO Anhydrotetracycline (aTc) Methylobacterium extorquens Christopher...baumannii Jason Peters 127088 pMS17 tcp830 Anhydrotetracycline (aTc) Streptomyces sp. Maggie Smith 74065...
  38. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...NHEJ). Double nicking strategies reduce unwanted off-target effects. Nickase mutants can also be used ...Publication 64325 3xFLAG-dCas9/p-bacteria 3xFLAG-dCas9 pLtetO-1 Fujii Efficient isolation of specific genomic...
  39. What's New in CRISPR - December 2019

    Type
    Blog Post
    ...cytosine base editors, which decrease the rate of off-target genome edits compared to rat APOBEC1. Now,...CRISPR/Cas9 in cells has advantages like reduced off-target activity and decreased immune response to ...ribonucleoproteins for transient expression. They replaced the tetraloop of the sgRNA scaffold with a com aptamer which...
  40. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...NHEJ). Double nicking strategies reduce unwanted off-target effects. Nickase mutants can also be used ... by DNMT3A or MQ1, and cytosine demethylation by Tet1. These modifications persist over time and are potentially...
  41. Viral Vectors 101: AAV Variables That Matter

    Type
    Blog Post
    ...) the consequences to your experiment if there’s off-target expression.   Once you know that, you’re ready...tyrosine-hydroxylase (TH), can limit which cells express your gene. Off-target expression can still occur (Fig. 3) - for ... two astrocyte selective promoters demonstrating off-target expression in both oligodendrocytes (Olig2...promoter allows you to decide when to turn on, or turn off, gene expression by administering an inducing agent...  Finally, the risks of potential toxicity and/or off-target effects (e.g. recombinase-dependent vectors...Ubiquitous promoters  These often-strong promoters offer the most flexibility for expression in a large number...2002). Lack of an Immune Response against the Tetracycline-Dependent Transactivator Correlates with Long-Term...
  42. What's New in CRISPR - May 2019

    Type
    Blog Post
    ... in the rat APOBEC1 that decreases the number of off-target RNA edits by >390 fold and >3,800 fold in .... coli genome-wide CRISPR inhibition Covalent tethering of DNA template to Cas9 SECURE base editors Nme2Cas9...genome-wide CRISPR inhibition library Covalent tethering of DNA repair template to Cas9 Homology-directed...
  43. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ... temporally control which genes are turned on or off in a given area and the can do so in a very specific...gene expression studies, which are evinced by the Tet system and visualization of single molecules via ... which allow you to easily and reversibly switch off and on your favourite signalling pathways (Figure...of the ribosome during translation, which knocks off all mRNA binding proteins as it travels along the...for Translation RNA Imaging by Coat protein Knock-off, is made up of three components: a GFP protein that...NLS-MS2-RFP) the reporter mRNA, which contains the tethering sites for the fluorescent proteins and an inducible...however, remain bound to the mRNA since they are tethered AFTER the stop codon. Thus a non-translated mRNA...
  44. Mouse Modeling, Part 1: Genetically Engineered Mice

    Type
    Blog Post
    ...some challenges still exist. Nucleases may cause off-target effects on regions of the genome with similar...either induce or repress Cre expression using TetON or TetOFF systems. So now hopefully creating a genetically... the cell can occur. Similar systems include tetracycline or doxycycline mediated activation of Cre to...
  45. Let There Be LITE Plasmids

    Type
    Blog Post
    ...designed to bind specific genes and turn them on or off, literally at the flip of a (blue) light switch. ...chromophores flavin-adenine dinucleotide and methyltetrahydrofolate, which are universally abundant. Second...apply LITEs for the transformation of neurons, she offers a tip: save yourself some time by making an AAV1...
  46. Teaching an Old DOG New Tricks: Controlling Protein Activity with GFP

    Type
    Blog Post
    ... GFP-binding nanobodies, the project really took off. Unlike most antibodies, nanobodies, which occur ...DNA-binding domains, including the commonly used LexA and rTetR systems such that they activate gene expression ...advantages. T-DOGGs can be made drug-inducible using the rTetR system, but Cre-DOG lacks the toxicity that can ...
  47. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ... Wheeldon FgH1tUTG 70183 Mammalian/Lentiviral H1-Tet none S. pyogenes Herold lentiGuide-Crimson 70683 ...Zhang pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA 73796 Yeast pRPR1(TetO) yes, interfere S. pyogenes... 65006 Bacteria BsaI yes, interfere S. pyogenes Koffas BPK764 65767 Bacteria BsaI yes, cut S. pyogenes...yes, nick S. pyogenes Duchek pAC5-dual-dCas9VP48-sgTetO 48237 Mammalian BbsI yes, activate S. pyogenes ...Joung AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR 68347 Mammalian/AAV none S. pyogenes Elverlov-Jakobsen...62315 Yeast none S. pyogenes URA3 Lim, Qi pRPR1(1xTetO)_gRNA_handle_RPR1t 62966 Yeast HindIII none S. ... Mammalian/Lentiviral hU6 none S. pyogenes Puro Moffat lenti sgRNA(MS2)_puro backbone 73795 Mammalian/...
  48. New CRISPR Web Resources and #12DaysofCRISPR Recap

    Type
    Blog Post
    ... on-target activity to siRNA, but with far fewer off-target effects! This characteristic probably explains... by DNMT3A or MQ1, and cytosine demethylation by Tet1. RNA Targeting: This page contains Cas13 constructs...
Showing: 1 - 50 of 79 results