Skip to main content

We narrowed to 140 results for: NUA

Showing: 1 - 20 of 140 results
  1. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...Insert Promoter PI Publication Last reviewed on: January 30, 2025 Do you have suggestions for other plasmids...
  2. Plan Your Experiment

    Type
    Collection
    ...While there are some cases where it makes sense to manually design a gRNA, in most cases gRNA design software...
  3. Validated gRNA Sequences

    Type
    Collection
    ...CCTCTTTGTCATCACGCTTC cut S. pyogenes 26789497 Corn AOC N. attenuata CAAAAGACTGTCAATTCCCT cut S. pyogenes 26479191 ...
  4. QC Sequencing Technologies at Addgene

    Type
    Blog Post
    ... next. If all three attempts fail, the QC team manually checks and assembles the raw data.  Addgene’s ...differences from the expected sequence, the QC team can manually revisit the assembly in a program called Geneious...length. Any mismatch or indel flags the sequence for manual review by one of our QC team members. This process...issue, the QC team developed a separate script for manually inputting known innocuous differences. This script...
  5. Tips for Getting a Faculty Position

    Type
    Blog Post
    ... Eight years ago, I decided to write a "how to" manual on applying for faculty positions in biomedical...committee is different and needs to be told all of the nuances of the research in as technical of language as ...insights. After I wrote the first version of my manual, I added new chapters to incorporate the experiences...graduate students encouraged me to publish this manual and earn some cash for my expensive habits of running...
  6. 5 Great Apps for Lab Life

    Type
    Blog Post
    ...Gibco Cell culture manual and basic instructional videos. The search function in the manual just highlights...very helpful, but does make it easy to skim the manual. Overall, it’s a great tool for someone starting...
  7. Countdown to Halloween @Addgene

    Type
    Blog Post
    .... Our Halloween costume contests have become an annual tradition in which we choose our teams and start... we continue to have an amazing turnout for the annual Halloween costume, so I expect some great costumes...
  8. Keeping Up With CRISPR/Cas9

    Type
    Blog Post
    ... in One-Cell Embryos. Niu Y, et al. Cell. 2014 January 30. (Pubmed) Programmable Removal of Bacterial ...CRISPR-Cas Systems. Ahmed A. Gomaa, et al. mBio. 2014 January 28. (Article). Read More: Other CRISPR Blog Posts...
  9. A Better Way to Get Customer Support: The Help Center

    Type
    Blog Post
    ...reach you. As with all of our resources, we will continually update the Help Center to make sure that, whatever...rest of our services, you can bet that we’ll be continually improving the support we provide based on your...
  10. Viral Vectors 101: Viral Applications

    Type
    Blog Post
    ... Therapeutic applications Vaccine development Attenuated and inactivated viruses pioneered vaccine development...Churchill MJ. Pathogenicity and immunogenicity of attenuated, nef-deleted HIV-1 strains in vivo. Retrovirology...
  11. Antibodies 101: Buffers, Storage, and Conjugates

    Type
    Blog Post
    ... Chart. Boston University Flow Core. Retrieved January 31, 2022, from https://www.bu.edu/flow-cytometry...Syracuse University Flow Core Facility. Retrieved January 31, 2022, from https://flowcore.syr.edu/help/spectral-overlap...
  12. Communicating Your Science With Help From ComSciCon

    Type
    Blog Post
    ...across the US and Canada convene at ComSciCon's annual flagship workshop.  Our 2018 workshop took place...apply for our future events. In addition to this annual event, graduate students in different regional ...
Showing: 1 - 20 of 140 results