Skip to main content

We narrowed to 47 results for: PRS

Showing: 1 - 20 of 47 results
  1. Educational Planarian Tools for Teaching Developmental Biology Techniques

    Type
    Blog Post
    ... into the empty PR-T4P vector backbone. The empty vector PLL4, which is similar to PR-T4P, is available...these planarian species. These plasmids all have a PR-T4 vector backbone, which is a modified version of...sequences for creating riboprobes and dsRNAs into PR-T4P. The Sánchez lab protocol also provides step-...
  2. Plasmids 101: Inducible Promoters

    Type
    Blog Post
    ...Repressor cI inhibits transcription from phage promoter pR, preventing expression of a reporter gene. When light...
  3. Sequencing Primers

    Type
    Guide
    ...promoter Forward pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Forward...
  4. Bacterial Expression Systems

    Type
    Collection
    ...Mycobacterium smegmatis Matthias Wilmanns 44447 pLC290 pR/cmtO p -isopropyl benzoate (cumate) Methylobacterium...Methylobacterium extorquens Christopher Marx 44448 pLC291 pR/TetO Anhydrotetracycline (aTc) Methylobacterium extorquens... and Venus) Escherichia coli Wolf Frommer 20336 pRsetB-his7-Perceval ATP:ADP ratio Fluorescence (GFP) ...
  5. Biosensor AAV Preps

    Type
    Collection
    ...Constitutive 1, 9, rg* Loren Looger 210400 PRS_8-GCaMP8m PRS jGCaMP8m none Constitutive 2 Simon Wiegert...
  6. 15 Years of Addgene: The Top 15 Plasmids

    Type
    Blog Post
    ...plasmid predates Addgene’s founding. Find pCMV-VSV-G. pRSV-Rev - This 3rd generation lentiviral packaging plasmid...plasmid pMD2.G, both deposited from the same lab. Find pRSV-Rev. pMDLg/pRRE - This is a 3rd generation lentiviral...contains the gag and pol genes. It also requires pRSV-Rev and the envelope expressing plasmid pMD2.G. ...
  7. Optogenetics + CRISPR, Using Light to Control Genome Editing

    Type
    Blog Post
    ...CRISPR-based systems in animal models. Use Anti-CRISPRs to Turn Off Genome Editing Single-chain Cas9 photoswitches... saCas9 protein. Stop light! Photoactive anti-CRISPRs halt Cas9 activity Anti-CRISPR proteins are a highly... study kinetics. Using chemistry to photocage CRISPRs The aforementioned techniques each employed a photoactive...
  8. Keeping Up With CRISPR/Cas9

    Type
    Blog Post
    ...already. I know we've discussed it before, but CRISPRs allow research to move so fast." On the very same...microbiome alone. (Seriously, is there anything CRISPRs can't do?) Structural details All this, and scientists...
Showing: 1 - 20 of 47 results