Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 20 of 240 results
  1. Giving gRNAs a Facelift - Synthetic and Beyond

    Type
    Blog Post
    ...the “gRNA” – suffers from the same issues as your experimental RNA. To solve this problem, gRNAs can be... triphosphate in the gRNA, reduce the innate immune response associated with gRNA introduction (Allen,... Check out Addgene’s validated gRNA repository to find pre-tested gRNA sequences for your next CRISPR ...advances in gRNA modification have overcome these woes with photoactivatable and photocleavable gRNAs. Photocleavable...linker in the 20-bp targeting region of the gRNA. These gRNAs can be cleaved and rendered useless after ... to generate a targeted break. These advances in gRNA technology have enhanced targeting efficacy as well...stress of worrying about the status of your RNA. gRNAs modifications are even going beyond stability, adding...
  2. CRISPR 101: Multiplex Expression of gRNAs

    Type
    Blog Post
    ...cleave the gRNAs. gRNAs are flanked by glycine tRNAs to create polycistronic glycine tRNA-gRNA (PTG) constructs...zebrafish!   Why use multiplexed gRNAs? By expressing multiple gRNAs on the same plasmid, you’ll make ...system for processing a continuous multi-gRNA transcript, each gRNA must be expressed from its own promoter...researchers to express multiple gRNA from a single construct. DNA and gRNA are not to scale.   Let’s... your chosen gRNA target sequences and clone them in just as you would for a single gRNA. You’ll clone...clone in the first gRNA using restriction enzyme BbsI and the second gRNA using restriction enzyme BsaI. ...Drosophila, a two-gRNA expressing plasmid is available from the Bullock lab, and gRNAs can be inserted ...
  3. Truncated gRNAs for Regulating Gene Expression

    Type
    Blog Post
    ...appropriately designed small RNA, or guide RNA (gRNA). The gRNA conventionally contains a 20-nucleotide sequence...along with the necessary gRNAs, but it would not be possible to control which gRNA becomes complexed with...truncated gRNAs An alternative approach is to modulate Cas9’s nuclease activity by modifying the gRNA with ...employed 20nt gRNAs. It should be noted, however, that on rare occasions truncated gRNAs (≤15nt) have ...recognize and bind to DNA; when complexed with a gRNA that directs them to the promoter of a gene of interest...species, each of which interacts with a distinct gRNA that allows users to decide which Cas9 protein is...protein itself. When native Cas9 is complexed with a gRNA that has been truncated such that it exhibits 15...
  4. How to Design Your gRNA for CRISPR Genome Editing

    Type
    Blog Post
    ...design gRNAs. You can also find validated gRNAs for your next experiment in Addgene's Validated gRNA Sequence...same is true when designing gRNAs for using CRISPR technology – the “best” gRNA depends an awful lot on what...restricting gRNAs to 5 – 65% of the protein coding region will still result in many dozens of gRNAs to choose... fewer gRNA to choose from, and thus an optimal sequence may not be available. Predicting gRNA efficacy...basis of the activity of a single gRNA, and thus diversity of gRNAs across a gene should be examined whenever...a less-active gRNA that targets a truly unique site in the genome, or a more-active gRNA with one additional...references therein. Nom nom nom. Me love gRNAs! Comic by Maya Kostman.   Important considerations...
  5. Searchable and Sortable gRNAs for Your Next CRISPR Experiment

    Type
    Blog Post
    ...validated gRNAs in our newly curated Validated gRNA Target Sequence Table. What are validated gRNAs? Proper...reagents, including many gRNA-containing plasmids (McDade et al, 2016). Many of the gRNAs contained within these...validated gRNAs can save you the time that would be spent making and testing entirely new gRNA designs....contains validated gRNA sequences. Validated in this context refers to the fact that every gRNA listed in the...to use our validated gRNA Target Sequence Table. Disclaimer: The efficacy of gRNAs is impacted by the ...validated gRNA table has been derived from scientists’ submissions, either their deposited gRNA plasmids...the validated gRNA sequences alone. Sequence submission is welcomed for validated gRNAs that are not generated...
  6. Back to Bacteria: CRISPR gRNA Multiplexing Using tRNAs

    Type
    Blog Post
    ... tRNA-gRNA and tRNA-gRNA-tRNA, with short 5’ spacer sequences preceding gRNAs, to test for gRNA cleavage...RNAs (gRNAs) are commonly packaged in 400-500 bp cassettes containing the RNA pol III promoter, gRNA and...cassettes (considering the gRNA itself is ~100 bases) limit the number of gRNAs that can be packaged together...multiplexing gRNAs used the RNA nuclease Csy4 from Pseudomonas aeruginosa to cleave 4 gRNAs separated by...cellular machinery to process gRNAs. Hijacking tRNA processing to make gRNAs In a recently published paper...high levels of gRNA cleavage.   Xie et. al constructed polycistronic glycine tRNA-gRNA genes (PTGs) in...U)tail in tRNA-gRNA constructs or a 1-4 base tail from the second tRNA in the tRNA-gRNA-tRNA constructs...
  7. CRISPR Plasmids - gRNAs

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila... CRISPR gRNAs CRISPR Plasmids: gRNAs Browse CRISPR Plasmids...Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts The table below lists gRNA plasmids designed to... questions to consider when choosing a gRNA: Does a given gRNA sequence exactly match your genomic target...Variation between a given gRNA sequence and your genomic target may reduce the gRNA activity. The variety ...pyogenes , S. aureus etc.) was this gRNA sequence designed for? A given gRNA sequence may only be compatible...gRNA expression vectors available from Addgene. CRISPR...
  8. Validated gRNA Sequences

    Type
    Collection
    ... Genome Engineering CRISPR Validated gRNA Sequence Datatable Validated gRNA Target...Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below lists gRNA sequences that have...Does a given gRNA sequence exactly match your genomic target? Variation between a given gRNA sequence and...pyogenes, S. aureus etc.) was this gRNA sequence designed for? A given gRNA sequence may only be compatible...indicate the Cas9 application the gRNA was designed to accomplish. Validated gRNA Sequence Datatable Target Gene...pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA 72619 cut S... Guigo, Johnson Malat1 H. sapiens gRNA1: GAACCGGTGGGGCTGCGTCA; gRNA2: GGCAGGAGAGGCCAGTTGCG 72620 cut S...
  9. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...Type Species PI Lentiviral Generation gRNAs per gene Total gRNAs Adamson DNA Repair CRISPRi Libraries ...Reduced Double-gRNA Library 137999 Knockout Human Parts 3rd 3 59,576 Human Whole Genome sgRNA iBAR Library...46,354 BARBEKO sgRNA Library 174163 Knockout, Base Editing Human Wei 3rd 3 53,502 sgRNA Pool for Streptococcus...
  10. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...genome. gRNA Empty Vectors Many gRNA empty vectors have been deposited at Addgene. To find the gRNA vector...expression of more sgRNAs in a single vector. sgRNAs are expressed as polycistronic glycine tRNA-gRNA genes (PTGs...Empty gRNA expression vectors for insertion of custom gRNA target sequences. CRISPR...target-specific gRNA in the same cell at the same time. Single plasmids containing both the gRNA and a Cas ...pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes Virmilion Bullock and Port pAc-sgRNA-Cas9 49330...S. pyogenes Joung pSPgRNA 47108 Mammalian BbsI none S. pyogenes Gersbach pUC57-sgRNA expression vector...
  11. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Halo_C_allele HNRNPA1 Halo ALS Michael Ward 178125 GRN_Halo_C_allele GRN Halo Frontotemporal dementia (FTD) Michael... HNRNPA1 His T7 ALS Tanja Mittag 178944 pAAV-mGrn-myc GRN Myc CBA Frontotemporal dementia (FTD) Erik Roberson... Parkinson's Frank Soldner 180439 STR-KDEL_PGRN-SBP-mCherry GRN SBP-mCherry CMV Frontotemporal dementia...Castañeda 176915 pcDNA3.1(+)_Paragranulin+linker 1 GRN Flag, Strep CMV Frontotemporal dementia (FTD) Thomas... Kukar 176917 pcDNA3.1(+)_Paragranulin-no linker GRN Flag, Strep CMV Frontotemporal dementia (FTD) Thomas...Thomas Kukar 176918 pcDNA3.1(+)_Granulin 1+linker2 GRN Flag, Strep CMV Frontotemporal dementia (FTD) Thomas...Thomas Kukar 176919 pcDNA3.1(+)_Granulin 1-no linker GRN Flag, Strep CMV Frontotemporal dementia (FTD) Thomas...
  12. New Optimized Genome-wide CRISPRko, CRISPRi, and CRISPRa Libraries

    Type
    Blog Post
    ...CRISPRko sgRNA library The Brunello library consists of 77,441 sgRNAs with an average of 4 sgRNAs per gene...contains two sets of sgRNAs; A, the top 3 ranked sgRNAs, and B, the next 3 ranked sgRNAs. Dolcetto was able...containing only 3 sgRNAs (setA) also outperformed CRISPRi libraries with 10 sgRNAs in the sgRNA metrics, confirming...2014 to predict sgRNA activity. In this study scientists examined approximately 1,900 sgRNAs and identified...subsampling analysis of the sgRNAs, Brunello even with only a single sgRNA outperformed another CRISPR...CRISPR library with 6 sgRNAS, highlighting the benefit of sgRNA design in CRISPR libraries. Thus, the Brunello... CRISPRko sgRNA library as pooled library or lentiviral prep! Dolcetto: human CRISPRi sgRNA library While...
  13. Custom CRISPR Screens & the Green Listed Software

    Type
    Blog Post
    ... gene is not targeted by only one gRNA, instead many different gRNAs are used for each gene. At the moment...contain 4-12 gRNAs/gene, which results in libraries containing up to around 200,000 different gRNAs. It has...should use ~400X more cells than gRNAs in a screen, to ensure that each gRNA has a good chance to contribute...multiple gRNAs targeting all genes in the indicated species and were suggested to be the best gRNAs by the...consensus on optimal gRNA design. With Green Listed you can also easily extract gRNAs for the same gene ...a full and a short name for each gRNA, as well as the suggested gRNA sequence including adapters. Output_UserInputParams... be very time consuming to design 5 guide RNAs (gRNAs) targeting each of the 1000 genes you’d like to ...
  14. CRISPR 101: Ribonucleoprotein (RNP) Delivery

    Type
    Blog Post
    ...While using Cas9-gRNA RNPs may require the production of the Cas9 protein and a gRNA in your laboratory...tips on gRNA design Resources on Addgene.org Browse all CRISPR plasmids Find validated gRNAs Check out...two components: the Cas9 protein and a guide RNA (gRNA) targeting your genomic site of interest. This is... Cas9 and contains a site for inserting a custom gRNA.  While this methodology has proven to be incredibly...Appropriate promoters must be chosen for both Cas9 and gRNA expression       Plasmid DNA may be incorporated...transcription and translation delays editing What are Cas9-gRNA ribonucleoproteins? One alternative approach, which... of the Cas9 protein in complex with a targeting gRNA, to your cells of interest. Cas9 RNPs are capable...
  15. CRISPR-based Genome Editing Systems For Editing in E. coli

    Type
    Blog Post
    ...at 37 °C.     The new pEcCas/pEcgRNA system We speculated that the gRNA on pCas that is specific to the...process begins with the addition of the sgRNA sequence in pEcgRNA. Next both plasmids are transformed in...generate pEcgRNA. The ccdB serves as a counterselection marker and will be replaced by the sgRNA targeting...system with the updated pEcCas/pEcgRNA system, and confirmed that indeed the gRNA-pMB1 had a slightly higher...the newly generated pEcCas/pEcgRNA system.   Advantages of the pEcCas/pEcgRNA system Compared with the ...20nt) on pEcgRNA plasmid as only two 24 nt oligos are required and the BsaI linearized pEcgRNA backbone... annealed 24 nt oligos to generate new pEcgRNA. pEcCas/pEcgRNA can be applied not only in coli K-12 strains...
  16. Tips for CRISPR Gene Editing in Mice

    Type
    Blog Post
    ...previously validated gRNAs at Addgene. In vitro screening for the best gRNA Not all gRNA’s are effective. ...individual gRNAs in their PX330 plasmids (or similar plasmids for gRNA expression), one gRNA at a time....different types of gRNA design software. When you are happy with your selection, ordering the sgRNA is simple ...can either scan the genome yourself for potential gRNA sites, or you can utilise several online tools that...the organism. It will then tell you the available gRNA targets in that region. The CRISPR Software Matchmaker...simple and easy. Several companies supply gRNA sequences, such as GenScript, ThermoFisher Scientific and OriGene...writing many of the specifics surrounding why some gRNA’s work better than others remain unknown, but fret...
  17. Visualizing Genomic Loci with CRISPR-Sirius

    Type
    Blog Post
    ...the gRNA tetraloop (a four base hairpin loop motif within the gRNA) resulted in a more stable gRNA than... hairpins within one gRNA will result in a blue, green, or red readout. But gRNAs containing two different...increasing gRNA stability. First, they began with the Broccoli aptamer system to visualize the gRNA in living...and Pederson created another sgRNA containing the PP7 hairpin sequence (sgRNA-Sirius-8XPP7) to recruit GFP...loci of interest. To determine how the sgRNA-Sirius-8XPP7 and sgRNA-Sirius-8XMS2 scaffolds performed, they...detection With a third sgRNA containing alternating MS2 and PP7 sequences (sgRNA-Sirius-4X(MS2-PP7)) that...developed CRISPRainbow (Ma et al., 2016), a set of gRNA scaffolds that contain two hairpin sequences (either...
  18. Tips for a 1st Time CRISPR User (by a 1st Time CRISPR User)

    Type
    Blog Post
    ...introduce the gRNA, but I just randomly chose one of my stable pools. Viruses containing BRAF gRNA (BRDN0000561167... Use multiple gRNAs to target different regions of your gene. I used existing BRAF gRNA viruses, but you...the BRAF-gRNA transduced cells, and no such edits in the cells transduced by the control GFP-gRNA (Figure...PMCID: PMC4262738. 3. EGFP gRNA (BRDN0000561167) (Plasmid #80034) and BRAF gRNAs (BRDN0001145345 and BRDN0001146266...CRISPR/Cas9 Deliver Multiple gRNAs at Once - Multiplex Expression of gRNAs Generating Mouse Models Using...efficient for gene editing. A virus encoding GFP plus a gRNA targeting GFP (pXPR_011, 59702-LV) was used to assay...Cas9 activity, guided by the virally-delivered GFP gRNA, will edit out the virally-delivered GFP gene. So...
  19. CRISPRainbow and Genome Visualization

    Type
    Blog Post
    ...editing, but it retains its gRNA-directed targeting capacity. By using a gRNA to target fluorescently labeled...did not observe labeling when a. no gRNA was present or b. when a gRNA binding a non-mammalian sequence ...approach: labeling the gRNA itself. In their CRISPRainbow paper, Ma et al. engineered gRNA scaffolds containing...individual colors to 6. A gRNA with all three hairpins generates white light. All 6 gRNAs can be expressed in...short, CRISPRainbow gRNA will permit labeling, but a newly expressed standard length gRNA would “switch” the...ratio of the system, they modified GFP-dCas9 and the gRNA scaffold to enhance complex assembly, thereby decreasing...protein-coding genes with both intronic and exonic gRNAs. In fact, the method is specific and sensitive enough...
  20. Pairing CombiGEM and CRISPR for Combinatorial Genetic Screening

    Type
    Blog Post
    ...RNAs (gRNAs) for genome editing in large-scale has led to the rapid generation of genome-wide gRNA libraries... containing one or more gRNAs. As each ligation reaction uses a pool of gRNAs as starting material, the...containing combinations of different gRNAs in each plasmid. Each gRNA combination can be tracked and quantitatively...and constantly improve gRNA libraries, excellent resources with effective gRNAs are publicly available...With a list of gRNA targeting sequences, you can then readily generate your barcoded gRNA library sequences...interrogating their functions. The continual advancements in gRNA design necessary to achieve maximal on-target and...CombiGEM platform provides a means to create barcoded gRNA libraries that can be used to combinatorially modify...
Showing: 1 - 20 of 240 results