Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 369 results for: epor

Showing: 181 - 200 of 369 results

  2. Plasmids 101: Control Plasmids

    Type
    Blog Post
    ...may be a plasmid that constitutively expresses a reporter protein (e.g., GFP or luciferase) that is either... well of your cells. Regardless, the amount of reporter protein activity correlates to both the amount...

  4. Fluorescent Proteins 101: When GFP lets you down

    Type
    Blog Post
    ...interest with an additional protein module that can report on location. This approach enables the study of...9759496.  3. Buckley, Anthony M., et al. "LOV-based reporters for fluorescence imaging." Current opinion in ...

  7. An Integrin Antibody Toolkit from IPI

    Type
    Blog Post
    ...in competition with other similar integrins, as reported by IPI and the Springer lab (Hao et al., 2024)...In this study, we, along with the Springer lab, reported the binding specificity, kinetics, and affinity...

  8. Plan Your Experiment

    Type
    Collection
    ...facilitates CRISPR/Cas9-based genome editing. Scientific Reports , 5 , 11315. https://doi.org/10.1038/srep11315 ...

  9. Generating Mouse Models Using CRISPR/Cas9

    Type
    Blog Post
    ... it a single nucleotide change, insertion of a reporter gene, or replacement of the murine sequence with... R (2013) One-Step Generation of Mice Carrying Reporter and Conditional Alleles by CRISPR/Cas-Mediated...

  11. Plasmids 101: Using Transposons in the Lab

    Type
    Blog Post
    ...piggyBac plasmids    Tol2  Tol2 was the first reported active DNA transposon in vertebrates. It was discovered...mutations. In these screens, the transposons encode reporter genes, mutagenic cassettes, or barcodes. When ...

  12. Live and Let Dye: Self-Labeling Protein Tags

    Type
    Blog Post
    ... self-labeling tools: Tetracysteine: The first reported chemical labeling tag, from Roger Tsien’s lab ...collection. CLIP-tag: Also in 2008, Kai Johnsson’s lab reported another AGT-based tag named CLIP-tag, which reacts...

  13. Sequencing Options for CRISPR Genotyping

    Type
    Blog Post
    ... unbiased methods, high background BLESS Not reported Cell-based (in vitro) Can be used on tissue from...senstive to time since cell fixing HTGTS Not reported Cell-based Identifies translocations Limited by...

  15. Custom CRISPR Screens & the Green Listed Software

    Type
    Blog Post
    ... for West-Nile-virus-induced cell death." Cell reports 12.4 (2015): 673-683. PubMed PMID: 26190106. PubMed...therapeutic targets in acute myeloid leukemia." Cell reports 17.4 (2016): 1193-1205. PubMed PMID: 27760321. ...

  16. CRISPR 101: Multiplex Expression of gRNAs

    Type
    Blog Post
    ...plasmids, which contain various promoters and reporters, and subsequently inserted into a Cas9-containing...-in-one CRISPR/Cas9 vector system.” Scientific Reports 4 (2014): 5400. PubMed PMID: 24954249. PubMed Central...

  19. Validated gRNA Sequences

    Type
    Collection
    ...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ...

  20. Optogenetics + CRISPR, Using Light to Control Genome Editing

    Type
    Blog Post
    ...system, Ye’s lab could edit a tdTomato fluorescent reporter gene in mice using Minicircle DNA vectors encoding...seen in the figure below. Next, by using a dual reporter fluorescence assay, Hemphill et al. demonstrated...
Showing: 181 - 200 of 369 results